We narrowed to 11,024 results for: cat.1
-
Plasmid#221273PurposeExpression of IRSp53 C-terminal truncation 1 (247-355) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pMSCV-FKBP-IRSp53(trunc N1)
Plasmid#221272PurposeExpression of IRSp53 N-terminal truncation 1 (257-375) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP-NIP45 delta-SLD2
Plasmid#210263PurposeInducible expression of N-terminally EGFP-tagged NIP45 delta-SLD2. Use with Flp-In T-Rex system.DepositorInsertNIP45 delta-SLD2 (aa 1-343) (NFATC2IP Synthetic)
TagsEGFPExpressionMammalianMutationdelta-SLD2PromoterCMV/TetO2Available SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1229)
Plasmid#192948PurposeFor membrane insertion study; expresses Tse5-CT (1169-1229)/PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1229)
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1229)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1300)
Plasmid#192956PurposeFor membrane insertion study; Expresses tse5-CT (1169-1300) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1300)
ExpressionBacterialMutationencodes for tse5 (1169-1300)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1317)
Plasmid#192957PurposeFor membrane insertion study; Expresses tse5-CT (1169-1317) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1317)
ExpressionBacterialMutationencodes for tse5 (1169-1317)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1269)
Plasmid#192954PurposeFor membrane insertion study; Expresses tse5-CT (1169-1269) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1269)
ExpressionBacterialMutationencodes for tse5 (1169-1269)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS238D1::sptse5-CT_phoA-lacZalpha
Plasmid#192961PurposeTest the biological function of the spTse5-CT (1169-1317)-PhoA (22-474)-LacZ (4-60) fusion protein in P. putidaDepositorInsertsptse5-CT_phoA-lacZ_
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1317) fused to phoA-lacZal…Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1229)
Plasmid#192953PurposeFor membrane insertion study; Expresses tse5-CT (1169-1229) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1229)
ExpressionBacterialMutationencodes for tse5 (1169-1229)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1281)
Plasmid#192950PurposeFor membrane insertion study; Expresses sptse5-CT (1169-1281) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1281)
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1281)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1269)
Plasmid#192949PurposeFor membrane insertion study; Expresses Tse5-CT (1169-1269)/PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1269)
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1269)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1300)
Plasmid#192951PurposeFor membrane insertion study; Expresses sptse5-CT (1169-1300) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1300)
TagsPelB signal peptideExpressionBacterialMutationencodes for sptse5 (1169-1300)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR207-MUM2sp-Citrine-ADPG2
Plasmid#170725PurposeGateway (Invitrogen) entry clone (pDONR207) containing the MUM2 (At5g63800) signal peptide (84bp) fused in-frame to the Citrine and the coding sequence of the HG degrading enzyme ADPG2 (At2g41850.1)DepositorInsertARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2 (PGAZAT Mustard Weed)
UseGateway donor vector / entry cloneTagsCitrine tag (714bp)Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-XMod-Doc (BMB-KO, S199AzF)-HIS
Plasmid#153445PurposeE. coli expression (amber suppression) of Rc. XDocB binding mode B knock-out mutant with serine at position 199 replaced with amber codon.DepositorInsertRc.XDocB
Tags6xHis and ybbr tagExpressionBacterialMutationSerine 199 was mutated to amber codon (TAG). Argi…PromoterT7 promoterAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
InsRA-eGFP
Plasmid#79795PurposeInsulin receptor isoform A with a inter-domain eGFP tag at extracellular region (between furin-like domain and transmembrane domain). For imaging insulin receptor trafficing.DepositorAvailable SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 His-GFP-EWSR1-myc-His
Plasmid#46385Purposeexpresses EGFP tagged EWSR1 in mammalian cellsDepositorAvailable SinceSept. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Myc-HNF4A
Plasmid#219396PurposeExpress HNF4A in mammalian cellsDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
InsRA-TagBFP
Plasmid#79791PurposeInsulin receptor isoform A with a inter-domain TagBFP tag at extracellular region (between furin-like domain and transmembrane domain). For imaging insulin receptor trafficing.DepositorAvailable SinceAug. 5, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
anti-Notch1_E6-pBIOCAM5
Plasmid#39344DepositorTags3xFLAG, 6xHis, and human FcExpressionMammalianPromoterCMVAvailable SinceOct. 30, 2013AvailabilityAcademic Institutions and Nonprofits only