We narrowed to 5,008 results for: AAT
-
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pLCHKO_PDPR_exon_deletion_2
Plasmid#155066PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_2
Plasmid#155074PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_4
Plasmid#155072PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-VGAT sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239030PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP-deltaNp53:WTp53
Plasmid#49244Purposeexpresses human p53 deltaN linked to full length p53 with C terminal His tag and also expresses EGFP in mammalian cellsDepositorAvailable SinceDec. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC1A7
Plasmid#131998PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC1A7 (SLC1A7 Human)
ExpressionMammalianAvailable SinceOct. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCHKOv3-CD46 Ex3_3-Lb
Plasmid#209029PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-As
Plasmid#209033PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJL1-dTomato
Plasmid#102631PurposeIn vitro expression of tdTomato from the T7 promoterDepositorInserttdTomato
ExpressionBacterialPromoterT7Available SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJL1-mTagBFP2
Plasmid#102638PurposeIn vitro expression of mTagBFP2 from the T7 promoterDepositorInsertmTagBFP2
ExpressionBacterialPromoterT7Available SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJL1-mRFP1
Plasmid#102630PurposeIn vitro expression of mRFP1 from the T7 promoterDepositorInsertmRFP1
ExpressionBacterialPromoterT7Available SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJL1-YPet
Plasmid#102633PurposeIn vitro expression of YPet from the T7 promoterDepositorInsertYPet
ExpressionBacterialPromoterT7Available SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJL1-mKalama1
Plasmid#102639PurposeIn vitro expression of mKalama1 from the T7 promoterDepositorInsertmKalama1
ExpressionBacterialPromoterT7Available SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJL1-mCherry
Plasmid#102629PurposeIn vitro expression of mCherry from the T7 promoterDepositorInsertmCherry
ExpressionBacterialPromoterT7Available SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP
Plasmid#102634PurposeIn vitro expression of sfGFP from the T7 promoterDepositorInsertsfGFP
Tagsstrep tagExpressionBacterialPromoterT7Available SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP082
Plasmid#103875PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces marxianusDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces marxianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJL1-eBFP2
Plasmid#102640PurposeIn vitro expression of eBFP2 from the T7 promoterDepositorInserteBFP2
ExpressionBacterialPromoterT7Available SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1(-) mouse C/EBP delta
Plasmid#12559DepositorInsertCCAAT/Enhancer-binding Protein delta (Cebpd Mouse)
ExpressionMammalianMutationS2G introduced during cloningAvailable SinceJuly 18, 2007AvailabilityAcademic Institutions and Nonprofits only