We narrowed to 58,602 results for: plasmid
-
Plasmid#122551PurposeBlock 1 for AdenoBuilder genome assemblyDepositorInsertAdenovirus 5 genomic region 1-3759
UseSynthetic BiologyPromoterNoneAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
p-dCas9-LSD1-Hygro
Plasmid#104406Purposetransient expression of dCas9-LSD1 fusion proteinDepositorInsertLSD1 (KDM1A Human)
UseCRISPRExpressionMammalianMutationIRATp970A0364D (Source Bioscience) has a P405H ch…PromoterCMV promoterAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS303-PADH1-AFB2
Plasmid#99530PurposeS. cerevisiae expression of F-box protein AFB2 under control of the ADH1 promoter, HIS3 marker (for use with the AID degron system)DepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY1330 STITCHR pCMV-nCas9-XTEN-v170_R2Tocc
Plasmid#234826PurposeSTITCHR R2Tocc editorDepositorInsertnCas9h840a-xten-R2Tocc
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_PE7-2A-BSD
Plasmid#234073PurposeFor lentiviral expression of PE7 with blasticidin resistanceDepositorInsertPE7
UseCRISPR and LentiviralTagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterEF-1α core promoterAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-iGABASnFR2-WPRE (AAV1)
Viral Prep#218874-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-iGABASnFR2-WPRE (#218874). In addition to the viral particles, you will also receive purified pGP-AAV-syn-iGABASnFR2-WPRE plasmid DNA. Syn-driven expression of the improved GABA sensor iGABASnFR2 (positive change in fluorescence). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_IRES_GFP_CD16a
Plasmid#196189PurposeRetroviral expression plasmid for generating stable FCGR3A (CD16a)-expressing cell lines.DepositorInsertCD16a (FCGR3A Human)
UseRetroviralExpressionMammalianMutationchanged Phenylalanine 158 to ValinePromoterLTRAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_T2A_mCherry sgAAVS1
Plasmid#192480PurposeAll-in-one plasmid for cutting non-targeting locus in DSB Spectrum V1 or V2 cells as controlDepositorInsertSpCas9
TagsT2A mCherryExpressionMammalianAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-axon-GCaMP6f (AAV1)
Viral Prep#112000-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSynapsin1-axon-GCaMP6f (#112000). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-axon-GCaMP6f plasmid DNA. Synapsin-driven, axon-targeted GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDY32 AAVS1-PuroR-9xTet0-minCMV-IGKleader-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA
Plasmid#161928PurposeDonor plasmid for integrating minCMV promoter-driven dual surface marker/fluorescent reporter at AAVS1 locusDepositorInsertSurface marker and Citrine activation reporter
UseSynthetic BiologyExpressionMammalianPromoterpEFAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM3D(Gq)-mCherry (AAV2)
Viral Prep#50476-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-CaMKIIa-hM3D(Gq)-mCherry (#50476). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hM3D(Gq)-mCherry plasmid DNA. CaMKIIa-driven hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsmCherryAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-GCaMP6M (AAV8)
Viral Prep#137120-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Con/Foff 2.0-GCaMP6M (#137120). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Con/Foff 2.0-GCaMP6M plasmid DNA. EF1a-driven expression of GCaMP6m in the presence of Cre recombinase (inhibited in the presence of Flp recombinase). These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-RfxCas13d-NLS-HA
Plasmid#141321PurposePlasmid to carry out IVT of RfxCas13d-NLS (human codon-optimized)DepositorInsertRfx-Cas13d (NLS-RfxCas13d-NLS)
UseCRISPRTagsHA and NLSAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-ymNeongreen-CaURA3
Plasmid#125703PurposeYeast tagging vector to create a gene fusion with yeast optimized mNeongreen with CaUra3 selection. *An updated version of this plasmid is available: #168059 pFA6a-link-ymNeongreen-URA3.DepositorInsertymNeongreen
ExpressionYeastAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pV1524
Plasmid#111431PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - inserts at Neut5L - Recyclable for serial mutagenesis (Mal2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES_Tomato
Plasmid#107229PurposeTomato expressing plasmidDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
EMMA toolkit
Plasmid Kit#1000000119PurposeCollection of Golden Gate vectors and standardized genetic parts for the construction mammalian expression plasmids.DepositorApplicationCloning and Synthetic BiologyVector TypeMammalian ExpressionCloning TypeGolden GateAvailable SinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSF3-Flag-FRB-Cbir_FKBP-Myc-Nbir
Plasmid#90009PurposeSplit-BioID plasmid: Expresses C-terminally tagged CBir[257-321]-FRB and C-terminally tagged NBir[2-256]-FKBPDepositorInsertsFKBP-linker-Myc-NBirA*
FRB-linker-CBirA*
UseRetroviral; Flp/frtTagsFLAG and MycExpressionMammalianPromoterCMVAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PIK3CA_p.E545K
Plasmid#82881PurposeGateway Donor vector containing PIK3CA, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only