We narrowed to 26,832 results for: gfp
-
Plasmid#23343DepositorInsertGFP(LVA)
TagsGFP(LVA)ExpressionBacterialAvailable SinceApril 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma12-GFP2
Plasmid#166781PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma12-GFP2 (GNG12 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma5-GFP2
Plasmid#166777PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma5-GFP2 (GNG5 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma3-GFP2
Plasmid#166775PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma3-GFP2 (GNG3 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma7-GFP2
Plasmid#166778PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma7-GFP2 (GNG7 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma4-GFP2
Plasmid#166776PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma4-GFP2 (GNG4 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma11-GFP2
Plasmid#166780PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma11-GFP2 (GNG11 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLS-SV40-mP-EGFP
Plasmid#137724PurposeLentivirus based EGFP expression vectorDepositorInsertSV40 enhancer
UseLentiviralExpressionMammalianAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3/TO/CD9-GFP
Plasmid#104402PurposeExpresses CD9 with mEmerald tag (NOT GFP) at the N terminalDepositorAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pg-HIF-1alpha-EGFP
Plasmid#87204PurposeC-terminally EGFP-tagged human HIF-1aDepositorAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
35S-sfGFP-nosT
Plasmid#80129PurposeTransient expression vector for sfGFP in plantsDepositorTypeEmpty backboneTagssfGFPExpressionPlantPromoterCaMV35SAvailable SinceAug. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 2
Plasmid#51761PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 2
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFA6a- mEGFP-kanMX6
Plasmid#105146PurposeYeast gene targetingDepositorInsertmEGFP-kanMX6
TagsmEGFPExpressionBacterial and YeastMutationA206KAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-VSP4-E228Q
Plasmid#80351PurposeExpression of GFP-tagged, dominant negative VPS4 mutantDepositorAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP2B-3x-55-96
Plasmid#232015PurposeExpression of 3 tandem copies of CHMP2B helix 2, connected with gly-ser linkers, attached to sfGFP.DepositorInsertCHMP2B (CHMP2B Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP2B-55-96
Plasmid#232014PurposeExpression of CHMP2B helix 2 attached to sfGFP.DepositorInsertCHMP2B (CHMP2B Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-DDX53-GFP
Plasmid#222239PurposeExpress GFP tagged DDX53 in mammalian cellsDepositorAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIV-EGFP.Flag-EZH2
Plasmid#220243PurposeExpresses wild-type EZH2 for knockout/rescue experiments in mammalian cells.DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO GFP
Plasmid#19444DepositorInsertGFP
ExpressionMammalianAvailable SinceOct. 6, 2008AvailabilityAcademic Institutions and Nonprofits only