We narrowed to 58,602 results for: plasmid
-
Plasmid#48345PurposeContributes the coding sequence for the mKate2 fluorescent protein as the 3’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertmKate2
UseGateway CloningMutationContains a stop codon at the 3' end of the c…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
FUW-TetON-GFP
Plasmid#115495PurposeLentiviral plasmid for tet-inducible expression of GFP (generated from plasmid #20321)DepositorInserteGFP
UseLentiviralAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
SPYtag-Histag-Avidin
Plasmid#214836PurposeThis plasmid encodes a protein (SPYtag-Histag-Avidin) that is used for generating functionalized magnetic beads for MagIC-cryo-EM, a method for single-particle cryo-EM analysis on magnetic beads.DepositorInsertSPYtag-Histag-Avidin
ExpressionBacterialPromoterT7Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-EGFP (AAV9)
Viral Prep#50457-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-DIO-EGFP (#50457). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-EGFP plasmid DNA. hSyn-driven, Cre-dependent EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTn Donor
Plasmid#236211PurposeArabinose-inducible Tn5 InducTn-seq plasmidDepositorInsertNone
ExpressionBacterialAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.GCaMP6f.WPRE.SV40 (AAV2)
Viral Prep#100836-AAV2PurposeReady-to-use AAV2 particles produced from pAAV.CAG.GCaMP6f.WPRE.SV40 (#100836). In addition to the viral particles, you will also receive purified pAAV.CAG.GCaMP6f.WPRE.SV40 plasmid DNA. CAG-driven GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-fDIO-Cre (AAV1)
Viral Prep#121675-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-fDIO-Cre (#121675). In addition to the viral particles, you will also receive purified pAAV-EF1a-fDIO-Cre plasmid DNA. EF1a-driven, Flp recombinase dependent expression of Cre recombinase. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-ChrimsonR-tdTomato (AAV1)
Viral Prep#171027-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Ef1a-fDIO-ChrimsonR-tdTomato (#171027). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO-ChrimsonR-tdTomato plasmid DNA. Flp-dependent, Ef1a-driven expression of ChrimsonR-tdTomato fusion for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagstdTomatoAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RNaseHI-NES-EGFP
Plasmid#196701PurposePlasmid for stable expression of wild type bacterial RNase HI tagged with NES and EGFP that can be used to specifically degrade the DNA-RNA hybrids in the cytoplasm.DepositorInsertbacterial RNaseHI
UseLentiviralAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8.91
Plasmid#187441PurposeLentiviral packaging plasmid expressing gag and pol.DepositorInsertsUseLentiviralAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pro-Code Vector Kit
Plasmid Kit#1000000177PurposeLentiviral plasmids with unique protein barcodes and gRNA cloning sites for CRISPR screens and tracking cell populations. Part of the Pro-Code Vector Kits.DepositorApplicationBarcoding, Genome EditingVector TypeLentiviral, Mammalian ExpressionEditing TypeCRISPRAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaMKII-somBiPOLES-mCerulean (AAV Retrograde)
Viral Prep#154948-AAVrgPurposeReady-to-use AAV Retrograde particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA. CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIa(0.4)TagsmCeruleanAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONRp5-p2 GFP-NShroom3-iLID
Plasmid#170976PurposeN-terminal component of OptoShroom3 optogenetic tool. Binds to apical junctions. pDONRp5-p2 plasmid.DepositorInsertNShroom3 (Shroom3 Mouse)
UseGateway CloningTagseGFP and iLIDMutationFrom isoform 2, deleted amino acids 1389 - 1805,…Available SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX303-ABI1-dCas9
Plasmid#154474PurposeExpresses ABI1 fused to the N terminus of dCas9DepositorInsertABI1 (ABI1 Mustard Weed)
UseLentiviralExpressionMammalianMutationIncludes ABI1 aa 126-423, D143APromoterCMVAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-OMP25
Plasmid#141150PurposeFluorescent labeling of the outer mitochondrial membrane (OMM) in mammalian cellsDepositorInsertOMP25 (Synj2bp Rat)
TagsAcGFPExpressionMammalianMutationOMP25 c terminus from addgene plasmid #69598PromoterCMVAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TRE-MA4-GFP
Plasmid#114380PurposeDoxycycline inducible MLL-AF4 and GFP expression. The construct has been used with CAG-rtTA for making engraftable iPSC derived HSCs.DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti F9-TetR-EGFP-IRES-PuroR
Plasmid#117049Purposelentiviral vector for expression of TetR-EGFP, for visualization of TetO repeatsDepositorInsertF9-TetR-EGFP
UseLentiviralTagsEGFPExpressionMammalianPromoterF9 promoterAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZ P (cHS4)X4 TetON-3XFLAG-tdT CAGG-m2rtTA v2
Plasmid#112669PurposeDonor vector for FLPe recombinase-mediated cassette exchange in master cell lines created with plasmid #112666. This vector allows inducible expression and contains cHS4 insulators.DepositorInserttdT
UseAAV; Donor plasmid for recombinase-mediated casse…ExpressionMammalianAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
hROSA26 CRISPR-pX330
Plasmid#105927PurposehROSA26 targeting CRISPR plasmidDepositorInserthROSA26 gRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2018AvailabilityAcademic Institutions and Nonprofits only