We narrowed to 23,749 results for: promoter
-
Plasmid#154057PurposeLevel 0 Golden Gate vector, containing the ZmUbi promoter and 5' UTR with Level 0.5-compatible overhangs (Wheat construct)DepositorInsertPromoter and 5' UTR Ubiquitin (Zea mays)
UseSynthetic BiologyExpressionBacterialPromoterN/AAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-PGAL1
Plasmid#41605DepositorInsertGAL1 promoter (GAL1 Budding Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…Available SinceDec. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-OCT4
Plasmid#69537PurposeEpisomal plasmid encoding 5 gRNAS targeting human OCT4 promoterDepositorInsert5 concatenated gRNA transcriptional cassettes targeting OCT4
UseCRISPRAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMXs-IG
Plasmid#51258PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLS (nuclear localization signal)ExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable SinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pL0-MtBCP1Pro
Plasmid#159415PurposeMedicago truncatula BCP1 promoter sequence (1108 bp immediately upstream of start codon) in pICH41295 MoClo Golden Gate level 0 acceptor for Pro+5U modules.DepositorInsertMtBCP1 Promoter
UsePuc19-derivedExpressionBacterialAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHes1-GFP (CC#109)
Plasmid#15133DepositorAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crScaffold_SV40-BFP
Plasmid#224860PurposecrRNA scaffold for RfxCas13d expressed from hU6 promoter and reporter BFP protein expressed from SV40 promoterDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRK-flag-USP19 C506S
Plasmid#78584PurposeExpression flag-USP19 C506S in mammalian cellsDepositorInsertflag-USP19 C506S (USP19 Human)
TagsflagExpressionMammalianMutationmutate 506 cysteine residue to serinePromoterCMVAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-p53 R175H
Plasmid#39480DepositorAvailable SinceSept. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLPP3
Plasmid#209965PurposeContains Level 0 Part: constitutive Promoter (P25) for the construction of Level 1 plasmidsDepositorInsertPromoter (P25)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP7
Plasmid#209969PurposeContains Level 0 Part: autoinducible Promoter (PfabZ) for the construction of Level 1 plasmidsDepositorInsertPromoter (P_fabZ)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP8
Plasmid#209970PurposeContains Level 0 Part: autoinducible Promoter (PgadB) for the construction of Level 1 plasmidsDepositorInsertPromoter (P_gadB)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP9
Plasmid#209971PurposeContains Level 0 Part: constitutive Promoter (PldhD) for the construction of Level 1 plasmidsDepositorInsertPromoter (P_ldhD)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP1
Plasmid#209963PurposeContains Level 0 Part: mock / negative control Promoter (P-nc) for the construction of Level 1 plasmidsDepositorInsertPromoter (mock)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP2
Plasmid#209964PurposeContains Level 0 Part: constitutive Promoter (P48) for the construction of Level 1 plasmidsDepositorInsertPromoter (P48)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pXPR_212
Plasmid#133457PurposeU6 promoter expresses customizable Spyo-guide; EFS promoter expresses SaurCas9 and 2A site provides puromycin resistanceDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-p53
Plasmid#39479DepositorAvailable SinceSept. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pXPR_213
Plasmid#133456PurposeH1 promoter expresses customizable Saur-guide; EF1a promoter expresses SpyoCas9 and 2A site provides blasticidin resistanceDepositorInsertControl guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
USP19 sgRNA2
Plasmid#78586Purposedelete USP19 gene in human cellDepositorAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only