We narrowed to 6,952 results for: Cad
-
Plasmid#80420Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 12 CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 12 CTG repeats (DMPK Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV iGluf
Plasmid#105833PurposeFast indicator for extracellular glutamate imagingDepositorInsertiGluSnFR E25D variant
UseTagsMyc and PDGFRExpressionMammalianMutationChanged Glu 25 to AspPromoterCMVAvailable sinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinVenus-S1033A
Plasmid#211896PurposeVinculin (chicken) with S1033 unphosphorylatable point mutation (S1033A) tagged with VenusA206K at the C-terminus, in lentiviral expression vector.DepositorInsertVinculinVenus-S1033A (VCL Chicken)
UseLentiviralTagsVenusA206KExpressionMutationmutated vinculin serine 1033 to alanine (S1033A),…PromoterCMVAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinVenus-S1033D
Plasmid#211897PurposeVinculin (chicken) with S1033 phosphomimetic point mutation (S1033D) tagged with VenusA206K at the C-terminus, in lentiviral expression vector.DepositorInsertVinculinVenus-S1033D (VCL Chicken)
UseLentiviralTagsVenusA206KExpressionMutationmutated vinculin serine 1033 to aspartic acid (S1…PromoterCMVAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mCherry-FKBP-GEF(TIAM1)
Plasmid#85156Purposeacute activation of Rac through rapamycin-induced translocation to membrane-localized FRBDepositorInsertFusion of mCherry, FKBP, and the DH-domain of human TIAM1 (amino acids 1012-1250)
UseTagsmCherry-FKBPExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a-hDcp2 E147Q, E148Q
Plasmid#72215Purposebacterial expression of His-tagged human Dcp2 Q147/8 mutant (disrupts the decapping function of Dcp2)DepositorInsertDcp2 (DCP2 Human)
UseTagsHisExpressionBacterialMutationE147Q, E148QPromoterT7Available sinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-POLArISact
Plasmid#164970PurposeT7 promotor drives in vitro transcription of POLArISact with a human kozak sequenceDepositorInsertPOLArISact
UseIn vitro transcriptionTagsExpressionMutationPromoterT7Available sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
SNAP-MIDAS
Plasmid#171604PurposeExpresses the SNAP-tagged MIDAS domain of S. pombe Mdn1 (a.a. 4381-4717) in bacteria.DepositorInsertMIDAS domain of S. pombe Mdn1 (a.a. 4381-4717)
UseTagsHis6 tag and SNAP tagExpressionBacterialMutationPromoterAvailable sinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_SNORD27h
Plasmid#73066Purposeexpression clone for human SNORD27 (C/D box snoRNA U27)DepositorInsertSNORD27 (SNORD27 Human)
UseTagsno tagExpressionMammalianMutationexpression cassette for SNORD27PromoterCMVAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-Venus-TmiR-Luc
Plasmid#25739PurposeControl lentiviral vector with Tet-based inducible expression of Luciferase miR30-based shRNA, constitutive Venus fluorescent protein coexpression.DepositorInsertLuciferase miR-shRNA
UseLentiviral and RNAiTagsVenusExpressionMammalianMutationPromoterAvailable sinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-Puro-GFPi
Plasmid#31848DepositorInsertGFP RNAi
UseCre/Lox, Lentiviral, and RNAiTagsExpressionMammalianMutationPromoterU6 for shRNA; Ef1alpha for mCherry-puromycinAvailable sinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-nCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197981PurposeT-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by UBQ10 gene promoter, flanked by ribozymes.DepositorInsertspco-nCasphi-2
AtPDS3 gRNA10
UseCRISPRTagsExpressionPlantMutationPromoterpUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LAP2-beta-actin in modified pEGFP
Plasmid#34839DepositorInsertLAP2-beta-Actin (ACTB Human)
UseTagsHAExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRvCAHS1-mEGFP-NLS
Plasmid#205013PurposeThe vector contains 1kbp of the upstream and downstream regions of the cahs1 gene from Ramazzottius varieornatus, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the cahs1 gene from Ramazzottius varieornatus
UseTardigrade expressionTagsExpressionMutationPromoterAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRvSAHS1-mCherry-NLS
Plasmid#205009PurposeThe vector contains 1kbp of the upstream and downstream regions of the sahs1 gene from Ramazzottius varieornatus, with the mCherry gene with NLS sequence positioned in between.DepositorInsertmCherry-NLS flanked by 1kbp upstream and downstream of the sahs1 gene from R. varieornatus
UseTardigrade expressionTagsExpressionMutationPromoterAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (1-1899)
Plasmid#170143PurposeExpresses residues 1-1899 of CHD7 in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
UseTagsFLAGExpressionInsectMutationC-terminal truncation of residues 1900-2997PromoterAvailable sinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (1-1547)
Plasmid#170144PurposeExpresses residues 1-1547 of CHD7 in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
UseTagsFLAGExpressionInsectMutationC-terminal truncation of residues 1548-2997PromoterAvailable sinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (K999R)
Plasmid#170142PurposeExpresses CHD7 (K999R) in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
UseTags6xHis and FLAGExpressionInsectMutationK999RPromoterAvailable sinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOPS0380
Plasmid#133230PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter Rlv3841pnifH (pOGG082), mCherry (EC15071) and T-pharma (pOGG003)
UseTagsExpressionBacterialMutationDomesticated for Golden Gate cloningPromoterAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only