We narrowed to 6,902 results for: sas
-
Pooled Library#234820PurposeUnique molecular identifiers-linked sgRNA library targeting chromatin factors (CH) in mice.DepositorExpressionMammalianSpeciesMus musculusUseCRISPR and LentiviralAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only
-
Watermelon
Pooled Library#155257PurposeLineage tracing libraryDepositorExpressionMammalianUseLentiviralAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLAG-SBP-STAG2 (WT)
Plasmid#73963PurposeSTAG2 cDNA (CCDS43990) wild typeDepositorAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSL3936 (pDonor(AAVS1)_Pse)
Plasmid#200903PurposeEncodes a mini-transposon derived from Pseudoalteromonas Tn7016 with a SA-T2A-PuroR-T2A-eGFP cargo. Total transposon size = 2,024 bp.DepositorInsertMini Tn7016 (AAVS1 NGS)
ExpressionMammalianAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSP2292
Plasmid#70707PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available SinceDec. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
gRNA_tdtomato_reporter_1_SA-2x
Plasmid#79369PurposeAssays activity of transcriptional activators fused to SA Cas9DepositorInserttdtomato
UseCRISPRExpressionMammalianAvailable SinceAug. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP2253
Plasmid#70704PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBK2043-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)Available SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-whiteCopyCatcher
Plasmid#174062PurposeCopyCatcher insertion donor for the white locusDepositorInsertwhite (w Synthetic, Fly)
ExpressionBacterialAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
MTK234_051
Plasmid#123919PurposeEncodes the saCas9 UAS (miniCMV core) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertpUAS sgRNA (Sa)
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NE1h (AAV9)
Viral Prep#123309-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_NE1h (#123309). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_NE1h plasmid DNA. hSyn-driven expression of GRAB-NE1h norepinephrine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-splitTVA-EGFP-tTA (AAV1)
Viral Prep#100798-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-FLEX-splitTVA-EGFP-tTA (#100798). In addition to the viral particles, you will also receive purified pAAV-syn-FLEX-splitTVA-EGFP-tTA plasmid DNA. Helper virus for monosynaptic tracing with rabies virus; to be coinjected with pAAV-TREtight-mTagBFP2-B19G (Addgene#100799). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TREtight-mTagBFP2-B19G (AAV1)
Viral Prep#100799-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-TREtight-mTagBFP2-B19G (#100799). In addition to the viral particles, you will also receive purified pAAV-TREtight-mTagBFP2-B19G plasmid DNA. Helper virus for monosynaptic tracing with rabies virus; to be coinjected with pAAV-syn-FLEX-splitTVA-EGFP-tTA (Addgene# 100798). These AAV preparations are suitable purity for injection into animals.DepositorPromoterTREtightTagsBFP (in presence of Cre and 100798)Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NE1m (AAV9)
Viral Prep#123308-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_NE1m (#123308). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_NE1m plasmid DNA. Synapsin-driven expression of GRAB-NE1m norepinephrine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NEmut (AAV9)
Viral Prep#123310-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_NEmut (#123310). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_NEmut plasmid DNA. hSyn-driven expression of GRAB-NEmut control norepinephrine sensor (does not respond to NE). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NE1m (AAV Retrograde)
Viral Prep#123308-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-GRAB_NE1m (#123308). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_NE1m plasmid DNA. Synapsin-driven expression of GRAB-NE1 norepinephrine sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
ML14
Bacterial Strain#61911PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. tyrA gene deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
ML17
Bacterial Strain#61912PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. glnA gene deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TLR targeting vector
Plasmid#64215PurposeTargeting vector for the human AAVS1 locus for insertion of traffic light reporter (TLR) constructDepositorInserttraffic light reporter (TLR) (AAVS1 Human)
UseHuman targetingMutationsee publication for detailsPromoterCAGAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only