We narrowed to 22,026 results for: his
-
Plasmid#42577DepositorInsertdelta-PRD ALIX (residues 1-702) (PDCD6IP Human)
UseTagsHIS-TEVExpressionBacterialMutationsilent mutation A1617G (numbering in ALIX gene)PromoterAvailable sinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pENTR4_FLAG/HA_FUS_His6
Plasmid#26365DepositorInsertFUS (FUS Human)
UseEntry vectorTagsFLAG/HA and His6ExpressionMutationdelta 527 (stop codon)PromoterAvailable sinceOct. 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
Sema7a-AP-His
Plasmid#72049PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema7a (Sema7a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
SPOCK1_23-439_HisN_AviC
Plasmid#195876PurposeBaculovirus expression for structure determination; may not be full ORFDepositorInsertSPOCK1 (SPOCK1 Human)
UsePfhmsp-avic-lic-n, baculovirus expressionTagsExpressionMutationPromoterPolyhedrinAvailable sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc4-HISNDHFR
Plasmid#63994PurposePosition 4 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable single tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneUseTags6xHis; TEV cleavableExpressionBacterialMutationPromoterT7Available sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pME18S-HismSin3A
Plasmid#30454DepositorInsertSin3A (Sin3a Mouse)
UseTagsHisExpressionMammalianMutationPromoterAvailable sinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTRCHisB-TRF2∆B
Plasmid#53208PurposeExpressed N-terminally Hexahistine tagged TRF2 Delta Basic proteinDepositorInsertTRF2 Delta Basic (TERF2 Human)
UseTags6x HisExpressionBacterialMutationcontains amino acids 47-500PromoterTrcAvailable sinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
Plxna1-AP-His
Plasmid#71996PurposeExpresses the extracellular region of the PlexinA1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertPlxna1 (Plxna1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema5a-AP-His
Plasmid#72035PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema5a (Sema5a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema4b-Fc-His
Plasmid#72155PurposeExpresses the extracellular region of the Sema4B protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema4b (Sema4b Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp1-AP-His
Plasmid#71971PurposeExpresses the extracellular region of the Neuropilin 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNrp1 (Nrp1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnb3-Fc-His
Plasmid#72130PurposeExpresses the extracellular region of the PlexinB3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertPlxnb3 (Plxnb3 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBS-Histone H1
Plasmid#45083DepositorInsertHistone H1
UseRNAi; In vitro transcriptionTagsExpressionMutationPromoterT7 sense, T3 antisenseAvailable sinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET3_HMV-His6
Plasmid#164843PurposeExpression of FL human metavinculinDepositorInsertVCL (VCL Human)
UseTagsHis6ExpressionBacterialMutationPromoterAvailable sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(S, +)-AP-His
Plasmid#72023PurposeExpresses the Sema3F protein (truncated at cleavage site P1; ie, short and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3f (Sema3f Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnb2(L)-Fc-His
Plasmid#72128PurposeExpresses the extracellular region of the PlexinB2 protein (ie, long), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertPlxnb2 (Plxnb2 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
Flrt1-AP-His
Plasmid#71947PurposeExpresses the extracellular region of the FLRT1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertFlrt1 (Flrt1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc1-HISDHFR
Plasmid#63935PurposePosition 1 transfer plasmid for pST44 polycistronic plasmid suite; N-term non-cleavable single tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneUseTags6xHisExpressionBacterialMutationPromoterT7Available sinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cntn4.2-AP-His
Plasmid#71942PurposeExpresses the entire Contactin 2, isoform 2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn4.2 (Cntn4 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only