We narrowed to 977 results for: plasmids spcas9
-
Plasmid#185492PurposeCMV and T7 promoter expression plasmid for human codon usage nSpCas9(D10A) with a C-terminal bi-partite NLS, 3x FLAG, and P2A-eGFPDepositorInserthuman codon usage nSpCas9(D10A)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-eGFPExpressionMammalianMutationD10APromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-Puro-U6-gRNA-pA plasmid
Plasmid#247671PurposespCas9 gRNA is driven by human U6 promoter, with the gRNA cassette between PuroR and pA, making it detectable in polyA-based RNA-seq.DepositorInsertPuromycin resistant gene
ExpressionMammalianPromoterTK promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
KO plasmid
Plasmid#135970PurposeExpresses SpCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneExpressionMammalianAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGG438
Plasmid#165486PurposeVector for expression of the SpCas9 VRKG variant in human cells: CMV-T7-humanVRKG(SpCas9, D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFLAGDepositorInsertMammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
UseCRISPRTags3x FLAG and SV40 NLSExpressionMammalianMutationD1135V, S1136R, D1332K, and R1333G mutations in S…PromoterCMV and T7Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LP102: pMAGIC (R4-R3) NLS-Sp Cas9-NLS
Plasmid#132927PurposepMAGIC R4-R3 entry plasmid, contains 2xNLS SpCas9 (nuclease active) for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInserthumanized SpCas9
UseCRISPR and Synthetic Biology; Pmagic gateway entr…Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX551
Plasmid#60957PurposepAAV-pMecp2-SpCas9-spA (AAV-SpCas9). AAV plasmid expressing Cas9 in neurons under control of truncated mecp2 promoter.DepositorInsertSpCas9
UseAAV and CRISPRTagsHAExpressionMammalianPromoterpMecp2Available SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-SpRYgest_targetplasmid (KAC833)
Plasmid#181748PurposepUC19 derivative plasmid used as a substrate for SpRYgest, restriction enzyme, and TtAgo digests. Encodes an SpCas9 EMX1-site1-NGG-PAM target site between NheI and HindIII restriction sites.DepositorTypeEmpty backboneUseSubstrate plasmidAvailable SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-GFP-U6-gRNA
Plasmid#79145PurposeAll-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in human pluripotent stem cellsDepositorInserteSpCas9(1.1)
UseCRISPRTags2A-GFPExpressionMammalianPromoterCAGAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
BPK1520_blastR
Plasmid#175289PurposeHuman expression plasmid for SpCas9 sgRNA with blasticidin co-selectionDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCMV/U6Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Toronto KnockOut version 3 library (TKOv3)
Pooled Library#90294PurposeOptimized library offering improved accuracy, efficiency, and scalability for CRISPR screens compared to TKOv1DepositorAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
hu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmid
Plasmid#154429Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmidDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmid
UseCRISPR and LentiviralExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
BPK1520
Plasmid#65777PurposeHuman expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNADepositorInsertSpCas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
PDG459 V3
Plasmid#226958PurposeCBh-SpCas9-2A-Puro, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_COL4A3_self-cleavingCas9
Plasmid#130281PurposeExpresses an spCas9 under the control of a CMV promoter; The spCas9 is flanked by COL4A3 sgRNA targets to induce its self-cleaving and inactivationDepositorInsertspCas9
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_COL4A5_self-cleavingCas9
Plasmid#130282PurposeExpresses an spCas9 under the control of a CMV promoter; The spCas9 is flanked by COL4A5 sgRNA targets to induce its self-cleaving and inactivationDepositorInsertspCas9
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti.Cas9.BFP.sgRNA.parental
Plasmid#196715PurposeSortable WT-SpCas9 expression and guide cassette (1-vector system).DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only