We narrowed to 4,666 results for: Gca
-
Plasmid#125415PurposeCRISPR-mediated repression of VPS13C. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR VPS13C-TSS-guide1
Plasmid#125412PurposeCRISPR-mediated repression of VPS13C. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR C2CD4AB-enh3-guide2
Plasmid#125409PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs17205526 (C2CD4A/B GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR C2CD4AB-enh3-guide1
Plasmid#125408PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs7163757 (C2CD4A/B GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR CAMK1D TSS-guide3
Plasmid#118179PurposeCRISPR-mediated repression of CAMK1D. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR OPTN TSS-guide1
Plasmid#118181PurposeCRISPR-mediated repression of OPTN. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR GLIS3 TSS-guide4
Plasmid#118176PurposeCRISPR-mediated repression of GLIS3. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR CAMK1D TSS-guide1
Plasmid#118177PurposeCRISPR-mediated repression of CAMK1D. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
KJ740(DE3)
Bacterial Strain#179486PurposeKJ740(DE3) is an OmpC-, OmpF-deletion strain of E. coli that allows for T7 promoter-based expressionDepositorBacterial ResistanceTetracycline (chromosome, Tn10) (10 μg/mL); Streptomycin/Spectinomycin (chromosome) (50 μg/mL)SpeciesEscherichia coliAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Syn61Δ3(ev5)
Bacterial Strain#174514PurposeRecoded E. coli strain without TCG, TCA, or TAG codons and deleted serT, serU and prfA genes. Full sequence - Genbank: CP071799.1DepositorBacterial ResistanceStreptomycinAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
TK310
Bacterial Strain#196340PurposeBacterial strain lacking adenlyate cyclase (cyaA, needed for cAMP synthesis) and phosphodiesterase (cpdA, which degrades cAMP); unable to control its intracellular cAMP levelsDepositorBacterial ResistanceNoneAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
C-5545 ∆cosδε
Bacterial Strain#209018PurposeDeficient in the P2 bacteriophage packaging cos site and encoding rhamnose-inducible P4 delta (δ) and epsilon (ε) genesDepositorBacterial ResistanceHygromycinSpeciesEscherichia coliAvailable SinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
XA92+pRCPam
Bacterial Strain#195855PurposeE. coli nonsense suppressor strain (glnX) transformed with plasmid carrying chromogenic protein (CP) with amber nonsense mutation in chromophore. Grows purple when CP is induced with rhamnose.DepositorBacterial ResistanceChloramphenicolSpeciesAcropora milleporaAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
HL2483
Bacterial Strain#62819PurposeLim Lab strain: MG1655 + lacIq intergrated at intS + Pcon::TetR inserted into the chromosome at galK + ΔglgCAP + ΔcsrB + ΔcsrC + ΔcsrDDepositorBacterial ResistanceNoneAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
eScaf
Bacterial Strain#220921PurposecssDNA production strainDepositorBacterial ResistanceNoneSpeciesEscherichia coliAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
TB205 △proC △trpR
Bacterial Strain#229546PurposeFluorescently labelled (mCherry) E. coli, auxotrophic for proline, tryptophan overproducerDepositorBacterial ResistanceNoneAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
DHL708
Bacterial Strain#98417PurposeBacterial Strain with Genotype: MC4100 ∆clpPXDepositorBacterial ResistanceStreptomycinAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
Syn61
Bacterial Strain#174513PurposeRecoded E. coli strain without TCG, TCA, or TAG codons in all open reading frames. Full sequence - GenBank: CP040347.1DepositorBacterial ResistanceStreptomycinAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only