We narrowed to 51,889 results for: IND
-
Plasmid#83359PurposeExpression of Antenna-Rac1DepositorInsertRac1 (RAC1 Human)
TagsFRET Antenna (mCerulean-cpVenus) and HisExpressionBacterial, Insect, and Mamm…PromoterCMVAvailable SinceMarch 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 KanR foundation lox casette
Plasmid#132388PurposeFoundation cassette containing lox sites for cre-mediated exchange of inducible vectors, confers mammalian G418 resistance, targets AAVS1 locusDepositorInsertG418 resistance
UseCRISPR and Cre/LoxExpressionMammalianPromoterpromoterlessAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
3xnls-cpmTq2-Calcium-lifetime-sensor
Plasmid#129626PurposeGenetically encoded calcium sensor (GECI) that reports with lifetime and intensity changesDepositorInsert3xnls-cpmTq2-Calcium-lifetime-sensor
Tags3xNLSExpressionMammalianPromoterCMVAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCLXSN-Tax
Plasmid#44038DepositorAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTYB11-PTBP1-RRM2CCtoSS
Plasmid#89154Purposerecombinant expression of PTBP1-RRM2 C250S,C251S in e.coliDepositorInsertPolypyrimidine Tract Binding Protein 1 RNA Recognition Motif 2 mutant C250S, C251S (PTBP1 Human)
TagsIntein and chitin binding domainExpressionBacterialMutationmutations: Cys 250 to Ser, Cys 251 to SerPromoterT7Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRS-45
Plasmid#40586DepositorTagsHis-tag and yTAND12ExpressionBacterialPromoterT7Available SinceSept. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
MLM3720
Plasmid#49944PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene for use as a controlDepositorInsert3x FLAG Tet1CDmut RH-3 (RHOXF2 Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Id2
Plasmid#70764PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Id2DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMTS_mScarlet-H_N1
Plasmid#85058PurposeIn vivo visualization of the mitochondria (can be used for colocalization studies)DepositorAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP-Hyg-CTCF-Nterm-N1
Plasmid#131800PurposeExpresses the [N-terminus of human CTCF (a.a. 2-265)]-GFP in mammalian cellsDepositorInsertCTCF (CTCF Human)
TagsGFPExpressionMammalianMutationdeleted amino acids 796-2181 (the N-terminus is l…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
JA740
Plasmid#49939PurposeExpresses a TALE-TET1FL (full length TET1) fusion protein engineered to bind a site in EGFP for use as a controlDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3762
Plasmid#49947PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene for use as a controlDepositorInsert3x FLAG Tet1CDmut RH-4 (RHOXF2 Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hGLIS1GR
Plasmid#59312PurposeForced expression of human GLIS1GRDepositorInsertGLIS1 (GLIS1 Human)
UseRetroviralTagscGR - hormone binding domain of glucocorticoid re…ExpressionMammalianAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
JA524
Plasmid#49938PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in EGFP for use as a controlDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-hMeCP2-R270X
Plasmid#48092PurposeBacterial expression of Mxe intein/chitin binding domain tagged MeCP2-R270XDepositorInsertMethyl-CpG Binding Protein 2 (Rett Syndrome) (MECP2 Human)
ExpressionBacterialMutationMxe intein/chitin binding domain tagged, expresse…Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-hMeCP2-G273X
Plasmid#48093PurposeBacterial expression of Mxe intein/chitin binding domain tagged MeCP2-G273XDepositorInsertMethyl-CpG Binding Protein 2 (Rett Syndrome) (MECP2 Human)
ExpressionBacterialMutationMxe intein/chitin binding domain tagged, expresse…Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS
Plasmid#59388PurposeDestination vector with RBPMS for stable cell line generationDepositorAvailable SinceFeb. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Myc-Idax DBM
Plasmid#68554PurposeThis plasmid expresses full length IDAX containing a DNA binding mutation.DepositorInsertIDAX-DBM (Cxxc4 Mouse)
TagsMycExpressionMammalianMutationT162A, H164A and Q165A mutationsPromoterEF1aAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only