We narrowed to 765 results for: streptococcus -(crispr) -(cas9)
-
Plasmid#196986PurposeFor SECRETS protocol to screen for gRNA activity and specificity: bacterial expression Cas9 in the presence of anhydrotetracycline (aTc).DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterpltetO1Available SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0202
Plasmid#185626PurposeMoClo Level 1, position 5 reverse, transcriptional unit for expression of plant codon optimized Cas9 from Streptococcus pyogenes driven by 35S promoterDepositorInsertSpCas9
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0001
Plasmid#185625PurposeMoClo Level 1, position 2 reverse, transcriptional unit for expression of plant codon optimized Cas9 from Streptococcus pyogenes driven by 35S promoterDepositorInsertSpCas9
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
cr3Vn
Plasmid#184861Purposecr3 helper plasmid for recombination and Cas9 induction; harbors the Cas9 endonuclease and an V. natriegens-specific recombination systemDepositorInsertCas9, gam, bet, exo
TagsCas9 ssrA degradation tagExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
cr3Ec
Plasmid#184860Purposecr3 helper plasmid for recombination and Cas9 induction; harbors the Cas9 endonuclease and an E.coli-specific recombination systemDepositorInsertCas9, gam, bet, exo
TagsCas9 ssrA degradation tagExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
cr3Dd
Plasmid#184862Purposecr3 helper plasmid for recombination and Cas9 induction; harbors the Cas9 endonuclease and a species-specific recombination systemDepositorInsertCas9, bet, exo
TagsCas9 ssrA degradation tagExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPomyces-1
Plasmid#61736PurposeStreptomyces expression of codon-optimized Cas9, tracrRNA, and custom crRNADepositorInsertssSpCas9
tracrRNA
crRNA cassette
UseCRISPRExpressionBacterialMutationBbsI-flanked lacZ cassette inserted in place of s…Promotergapdhp(EL), rpsLp(CF), and rpsLp(XC)-BbsIAvailable SinceJan. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSL690
Plasmid#47753PurposeExpresses dCas9-VP64 fusionDepositorInsertdCas9-VP64
UseCRISPRTags3x FLAG, NLS, and VP64ExpressionMammalianMutationD10A and H840A mutations in Cas9PromoterCMVAvailable SinceAug. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDG330
Plasmid#100898PurposeSpCas9 with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAGExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRB14
Plasmid#52522Purposeexpresses a myc-tagged version of hCas9 in DrosophilaDepositorInsertS. pyogenes cas9 with humanized codon bias
TagsmycExpressionInsectPromotertubulinAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAGM4723:TpCC_Urease
Plasmid#85982PurposeGolden Gate Level 2 construct encoding Cas9-YFP and 2 urease-targeting gRNAsDepositorInsertsCas9
Urease-targeting gRNA 1
Urease-targeting gRNA 2
UseCRISPR; Diatom (t. pseudonana)TagsNLS and YFPPromoterFCP and U6Available SinceJan. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
Modular BE4max for GG insertion
Plasmid#198891PurposeEasily insert deaminase of choice into BE4max using Golden Gate cloningDepositorInsertCRISPR associated protein 9 (cas9 Streptococcus pyogenes)
TagsNLSExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDG458
Plasmid#100900PurposeSpCas9 with 2A-EGFP and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAGExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMM178
Plasmid#61270PurposeAlso referred to as pRGNndm-1. Expresses Cas9, tracrRNA and a guide RNA which target the NDM-1 gene. Contains a pBBR1 origin and chloramphenicol resistance.DepositorInsertCas9, tracrRNA, crRNA
UseCRISPRTags6xHisExpressionBacterialPromoterpLtetO, native, native (respectively)Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMM441
Plasmid#61271PurposeAlso referred to as mRGNndm-1. Expresses Cas9, tracrRNA and a guide RNA which target the NDM-1 gene. Contains an R1162 origin and chloramphenicol resistance. Can be mobilized by S17-1 lambda pir.DepositorInsertCas9, tracrRNA, crRNA
UseCRISPRTags6xHisExpressionBacterialAvailable SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMJ922
Plasmid#78312PurposeExpression of His6-MBP-tagged Cas9-NLS-EGFP protein in E. coliDepositorInsertSpCas9
TagsHA-2xNLS-EGFP-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available SinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMJ923
Plasmid#78313PurposeExpression of His6-MBP-tagged Cas9-NLS-mCherry protein in E. coliDepositorInsertSpCas9
TagsHA-2xNLS-mCherry-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available SinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only