We narrowed to 5,019 results for: AAT
-
Plasmid#205787PurposeExpress mEGFP-tagged fusion protein, CBFB_MYH11 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
-
pDEST 3x Flag-pcDNA5-FRT/T0-BRCA1
Plasmid#52504Purposemammalian expression vector of BRCA1 wildtype siRNA resistantDepositorInsertBRCA1 (BRCA1 Human)
TagsFlagExpressionMammalianMutationsiRNA resistant sequence: AGTATAATCPromoterCMVAvailable SinceFeb. 4, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLentiCRISPRv1-sgPHGDH-G5
Plasmid#83913Purposestable knockoutDepositorInsertPhosphoglycerate dehydrogenase (PHGDH Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceOct. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,ā¦ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGGā¦PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001149033)
Plasmid#77531Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAGI1 gRNA (BRDN0001487062)
Plasmid#78068Purpose3rd generation lentiviral gRNA plasmid targeting human MAGI1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-4
Plasmid#223225Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pRSITEP-puro-shWRN1
Plasmid#125783PurposeDOX-inducible expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
PRKDC gRNA (BRDN0001146589)
Plasmid#77861Purpose3rd generation lentiviral gRNA plasmid targeting human PRKDCDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2AmCherry-W
Plasmid#163176PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
MAP2K4 gRNA (BRDN0001145028)
Plasmid#76650Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST Halo-flag-CAD
Plasmid#188117PurposeExpresses N-terminal Halo-tagged/C-terminal flag-tagged human CAD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tag and Halo tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimiā¦Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2-shATRX
Plasmid#124258PurposeExpresses shRNA targeting ATRX. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshATRX
ExpressionMammalianAvailable SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shWRN1
Plasmid#125781Purposeconstitutive expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anti-EAAC1 [N420/24R]
Plasmid#206572PurposeMammalian Expression Plasmid of anti-EAAC1 (Rat). Derived from hybridoma N420/24.DepositorInsertanti-EAAC1 (Rattus norvegicus) recombinant Mouse monoclonal antibody (Slc1a1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-EAAC1 [N180/41R]
Plasmid#206615PurposeMammalian Expression Plasmid of anti-EAAC1 (Rat). Derived from hybridoma N180/41.DepositorInsertanti-EAAC1 (Rattus norvegicus) recombinant mouse monoclonal antibody (Slc1a1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-5)-PGKpuroBFP-W
Plasmid#211987PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKmt2d#2/Cre
Plasmid#173598PurposeExpresses a Kmt2d-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kmt2d (Kmt2d Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only