We narrowed to 27,775 results for: GFP
-
Plasmid#225662PurposeLentivirus protein expression. Matched control construct for 8522-M01-663 (Addgene # 225660) gives basal expression from mCMVp for gating/thresholdingDepositorInsertdsCopGFP
UseLentiviralPromotermCMVpAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_191
Plasmid#111821PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 171-191
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available sinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma5-GFP2
Plasmid#166777PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma5-GFP2 (GNG5 Synthetic, Human)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable sinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma3-GFP2
Plasmid#166775PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma3-GFP2 (GNG3 Synthetic, Human)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable sinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRS406-PHO5-GFP-OSBP PH domain
Plasmid#58840PurposeExpresses GFP-Tagged OSBP PH domain in yeastDepositorAvailable sinceJan. 20, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMC-ME_memb-EGFP-pA
Plasmid#200520PurposeMini circle middle entry plasmid for membrane GFP- pA with flanking BsaI cut sitesDepositorInsertmemb-GFP
UseMini-goldenAvailable sinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChromeT-GFP
Plasmid#123316PurposeAAV-mediated expression of ChromeT-GFP under the Syn promoter.DepositorInsertChromeT-GFP
UseAAVTagsGFPExpressionMammalianMutationChannelrhodopsin-2 (ChR2) with mutations A71S/ E9…PromoterSynAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGC681
Plasmid#107019PurposeGFP reporter of lag-2 driven by 405 bp of promoterDepositorInsertGFP-PH
TagsGFPExpressionWormPromoterlag-2Available sinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGC643
Plasmid#107016PurposeGFP reporter of lag-2 driven by 0.5 kb promoterDepositorInsertGFP-PH
TagsGFPExpressionWormPromoterlag-2Available sinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGustiv
Plasmid#240335PurposeExpresses BK polyomavirus genotype IV capsid protein VP1 in yeast. Expression of VP1 (and a GFP reporter) is induced by maltose.DepositorInsertsBKV-IV VP1
Superfold GFP
Formaldehyde dehydrogenase 1
ExpressionYeastPromoterFDH1, MAL31, and MAL32Available sinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMPMA3dPlac-PfliC-GFPLVA
Plasmid#23342DepositorInsertGFP(LVA)
TagsGFP(LVA)ExpressionBacterialAvailable sinceApril 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTHSSe_37
Plasmid#109237PurposePTac driving GFPDepositorInsertsfGFP
ExpressionBacterialPromoterPTacAvailable sinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMART-HCKan-yibDp-roGFP2
Plasmid#202462PurposeExpresses redox sensitive GFP (roGFP) after phosphate depletionDepositorInsertreduction-oxidation sensitive green fluorescent protein
ExpressionBacterialPromoteryibDpAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry GFP
Plasmid#78535PurposeControl plasmid (paired gRNAs against GFP)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMRBAD-link-CGFP
Plasmid#52733PurposeL-(+)-arabinose-inducible expression of link-CGFP negative control for in vivo split GFP assembly assayDepositorInsertlink-CGFP
ExpressionBacterialPromoterPBADAvailable sinceMay 7, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
peGFP C3-SPG20
Plasmid#218578PurposeExpresses GFP-tagged human SPG20 in mammalian cellsDepositorAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRM4 - [BAGp | gfp | tbb-2 UTR]
Plasmid#204617Purposegfp BioPart for BAG neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[BAGp | gfp | tbb-2 UTR]
ExpressionWormAvailable sinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTipi2.2c
Plasmid#252901PurposeGolden gate destination vector, allows for expression of recombinant proteins, no C-term tagDepositorPublicationTypeEmpty backboneExpressionMammalianPromoterCMVAvailable sinceApril 6, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTipi2.2d
Plasmid#252902PurposeGolden gate destination vector, allows for expression of recombinant proteins, no tagsDepositorPublicationTypeEmpty backboneExpressionMammalianPromoterCMVAvailable sinceApril 6, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits