We narrowed to 62,256 results for: cloning
-
Plasmid#141273PurposeGateway-compatible Entry vector, with insert of the envelope (E) gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorHas ServiceCloning Grade DNAInsertE (E SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
GoldenBraid 2.0 Kit
Plasmid Kit#1000000076PurposePlant synthetic biology kit for GoldenBraid cloning and multigene engineering, including CRISPR/Cas9 parts.DepositorApplicationCloning and Synthetic Biology, Genome EditingVector TypePlant ExpressionEditing TypeCRISPRCloning TypeGolden Gate (GoldenBraid)Available SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET mCerulean LIC cloning vector (u-mCerulean)
Plasmid#29773DepositorTypeEmpty backboneTagsmCeruleanExpressionBacterialAvailable SinceJune 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAJ13
Plasmid#14915DepositorInsertmultiple cloning site 3
ExpressionWormAvailable SinceJuly 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG-Hypa
Plasmid#218165PurposeThis plasmid harbors the base editor eSCBE3-NG-Hypa along with an sgRNA cloning cassette, facilitating high-efficiency and high-fidelity cytosine base editing at targets bearing NG PAM in StreptomycesDepositorInsertsescbe3-NG-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
Plasmid#60226PurposeExpresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Renilla luciferase
Cre recombinase
UseAAV, CRISPR, Cre/Lox, Luciferase, and Mouse Targe…TagsCre-HA and Rluc-P2AExpressionMammalianPromoterEFS and U6Available SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 M
Plasmid#141274PurposeGateway-compatible Entry vector, with insert of the membrane (M) gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorHas ServiceCloning Grade DNAInsertM (M SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET His6 Mocr TEV LIC cloning vector (1O)
Plasmid#29658DepositorTypeEmpty backboneTags6xHis, Mocr, and TEV cleavage siteExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJR85
Plasmid#140095PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region. BsmBI sites were removed to allow for programmed dual sgRNA library cloning.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-AtU6-1
Plasmid#66202Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET Flag TEV LIC cloning vector (2L-T)
Plasmid#29715DepositorTypeEmpty backboneTagsFLAG-TEVExpressionBacterialAvailable SinceJune 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET His6 NusA TEV LIC cloning vector (2N-T)
Plasmid#29709DepositorTypeEmpty backboneTagsHis6-NusA-TEVExpressionBacterialAvailable SinceAug. 17, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA
Plasmid#73796PurposepRS416 Ura marked Cen/Ars plasmid with dCas9-Mxi1 under Tef1 promoter, and tet-incucibile RPR1 promoter with NotI cloning site adjacent to gRNADepositorInsertsdCas9-Mxi1
Tet Repressor
Structural gRNA for S pyogenes
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1, pRPR1(TetO), and pTef1Available SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET His10 TEV LIC cloning vector (2B-T-10)
Plasmid#78173DepositorTypeEmpty backboneTags10xHis and TEV cleavage siteExpressionBacterialPromoterT7Available SinceMay 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET mCerulean LIC cloning vector (H6-mCerulean)
Plasmid#29726DepositorTypeEmpty backboneTags6xHis, AviTag (biotin), TEV cleavage site, and mC…ExpressionBacterialAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET StrepII TEV LIC cloning vector (2R-T)
Plasmid#29717DepositorTypeEmpty backboneTagsStrepII-TEVExpressionBacterialAvailable SinceJune 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2906
Plasmid#91093PurposeModule C, Promoter: FMV 34S, Gene: TREX2 (+ BaeI site for GT donor cloning), Terminator: pea rbcsE9DepositorAvailable SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
BPK1520
Plasmid#65777PurposeHuman expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNADepositorInsertSpCas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJR89
Plasmid#140096PurposesgRNA constant region and hU6 insert for programmed dual sgRNA cloning. The sgRNA constant region contains a capture sequence (cs1) in the stem loop for direct capture Perturb-seq.DepositorInsertsgRNA constant region CR3 with cs1 in stem loop and hU6 promoter
Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only