We narrowed to 35,296 results for: multi
-
Plasmid#187599PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Apramycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-CNL
Plasmid#65712PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-CNL)DepositorInsert7xTcf, minCMV, 3xNLS, CNL
UseLuciferaseAvailable SinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
p221z-erVenusYFP
Plasmid#71265PurposeEntry clone containing ER-localized Venus. Can be used to construct transcriptional reporters. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertVenusYFP
UseGatewayTagsER retention signal HDEL and signal peptide (ER)…Available SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p221z-erTagRFP
Plasmid#71266PurposeEntry clone containing ER-localized TagRFP. Can be used to construct transcriptional reporters. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTagRFP
UseGatewayTagsER retention signal HDEL and signal peptide (ER)…Available SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p221k-erTq2CFP
Plasmid#71264PurposeEntry clone containing ER-localized Turqoise2. Can be used to construct transcriptional reporters. For use in plants and compatible with the MultiSite Gateway system.DepositorInsertTq2CFP
UseGatewayTagsER retention signal HDEL and signal peptide (ER)…Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
MF81_PB-TRE3G-12x42bs-6x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA
Plasmid#176625PurposeTF A self-activation cassette in MultiFate-2.1DepositorInsertTRE3G-12x42bs-6x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA
UseSynthetic BiologyAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAC5-dual-dCas9VP48-sgTetO
Plasmid#48237PurposeDual expression construct expressing both dCas9VP48 and sgTetO from separate promotersDepositorInsertdCas9VP48 and sgTetO
UseCRISPRTagsHA-tag and VP48ExpressionMammalianMutationD10A H840A (catalytically inactive)Available SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDRf1-4CL5-AtSCT (JBEI-11557)
Plasmid#87937PurposeCo-expression in S.cerevisiae of 4CL5 and AtSCTDepositorInsertsExpressionYeastAvailable SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10714
Plasmid#183959PurposeU6-crKlf4-CAG-hyperdCas12a-miniVPRDepositorInsertsHyperdCas12a
crRNA targeting Klf4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-ONL
Plasmid#65713PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-ONL)DepositorInsert7xTcf, minCMV, 3xNLS, ONL
UseLuciferaseAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTK-EdnrbE2-Sox10-FLAG-tev-AVI
Plasmid#127775PurposeModified pTK plasmid containing chicken EdnrB E2 enhancer driving expression of full length Chicken Sox10 in frame with a Flag-tag and Avi-tagDepositorAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV loxP L5-L2
Plasmid#62094PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and multiple cloning site flanked by loxP sites. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCre/Lox; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-flag-Lag16-fibcon-iCAM1-tether
Plasmid#205213PurposeThis vector encodes of the synCAM tether (fibcon - iCAM1) and GFP nanobody LAG16DepositorInsertsynCAM fibcon - iCAM1 Tether and Lag16 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2
Plasmid#186413PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined NLSLacZ under control of an AttB3/B5 recombined reg. sequence.DepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3_mTq-Tat (c-plasmid)
Plasmid#127635PurposeEncodes a fluorecent protein with an RNA binding peptide: mTurquoise2-tat.Expression with constitutive E. coli RNAP promoter (J23106), ribozyme PlmJ and RBS BBa_B0034.DepositorInsertmTurquoise2
UseSynthetic BiologyTagsRNA binding peptide: PCP and RNA binding peptide:…ExpressionBacterialAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
CoxVIIIx2-CeNL(Ca2+)_1.2μ-pcDNA3
Plasmid#111922PurposeCyan color luminescent indicator for calcium signaling.Mitochondrial targeting signals of subunit VIII of human cytochrome c oxidase (CoxVIII) were fused at the N-terminus of CeNL(Ca2+)_1.2μDepositorInsertCeNL(Ca2+)_1.2μ
TagsCoxVIIIx2ExpressionMammalianMutationE67D, E104D, D133E at CaMPromoterCMVAvailable SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
EcNGRfC
Bacterial Strain#48936PurposeBase line strain is heat shock induce-able lambda red recombination system for MAGE (Multiplex Recombination Genome Engineering)DepositorBacterial ResistanceSpectinomycinAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
EcNGRfEfC
Bacterial Strain#48937PurposeBase line strain is heat shock induce-able lambda red recombination system for MAGE (Multiplex Recombination Genome Engineering)DepositorBacterial ResistanceSpectinomycinAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only