We narrowed to 14,327 results for: cas9 genes
-
Plasmid#128178PurposeExpresses gRNA using fusion of R. toruloides 5S rRNA and tRNA-Arg as promoterDepositorInsertgRNA cloning cassette
UseCRISPRExpressionYeastPromoter5S rRNA-tRNA(Arg)Available SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Rad18UBD
Plasmid#119005PurposeMammalian expression of the human Rad18 Ubiquitin binding domain and BFPDepositorInsertRad18
ExpressionMammalianPromoterCAGAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-RNF169UBD
Plasmid#119006PurposeMammalian expression of the human RNF169 Ubiquitin binding domain and BFPDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pUPRT::DHFR-D
Plasmid#58528Purposereplace TgUPRT with DHFR by homologous recombinationDepositorInsertDHFR cassette
UseGateway cloningMutationpyrimethamine resistantPromoterDHFRAvailable SinceAug. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
U6-(BbsI)sgRNA_CAG-Venus-bpA
Plasmid#86985PurposeFor cloning and expression of sgRNA together with Venus expressionDepositorInsertVenus
ExpressionMammalianMutationVenus GFP variantPromoterCAGAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-RNF169
Plasmid#119004PurposeMammalian expression of human RNF169 and BFPDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOC4 cloning template vector
Plasmid#183423PurposeFlpON knock-in vector with FLAG-SpCas9 expressionDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-SPNM-B
Plasmid#48661PurposeBacterial SP and NM repression YFP reporter: protospacer BDepositorInsertSP/NM prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
Hulk-ubi-lacZ-to-Green
Plasmid#108641Purposeubiquitous promoter followed by a lacZ to GFP lineage tracing line. Cryst:venusGFPDepositorInsertubi-lacZ-to-GFP
Available SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-TetR-Rad18UBD
Plasmid#119010PurposeMammalian expression of a fusion protein of single chain Tet repressor with the human Rad18 Ubiquitin binding domain and BFP expressionDepositorInsertTetR
ExpressionMammalianPromoterCAGAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Trex2-bpA
Plasmid#86984PurposeExpression of mouse Trex2DepositorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG1
Plasmid#90276Purpose(also pMST621-BB3_gpyrG1_cas9) CRISPR/Cas9 plasmid with gRNA for pyrG1, Cas9DepositorInsertgRNA (pyrg1)
UseA. nigerExpressionBacterialAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMLS234
Plasmid#73682PurposeSapTrap 3-site Destination vector for N-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330_HR_Prnp_3
Plasmid#78621PurposepX330 vector encoding SpCas9 and a chimeric guide RNA targeting Prnp coding sequenceDepositorInsertpX330_HR_Prnp_3
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6Available SinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-TetR-RNF169UBD
Plasmid#119011PurposeMammalian expression of a fusion protein of single chain Tet repressor with the human RNF169 Ubiquitin binding domain and BFP expressionDepositorInsertTetR
ExpressionMammalianPromoterCAGAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-TD-B
Plasmid#48663PurposeBacterial TD repression YFP reporter: protospacer BDepositorInsertTD prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-A
Plasmid#48665PurposeBacterial ST1 repression YFP reporter: protospacer ADepositorInsertST1 prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only