We narrowed to 10,223 results for: Uty
-
Plasmid#184404Purposeyeast surface display of the SARS-CoV-2 Eta variant RBDDepositorInsertSARS-CoV-2 Eta Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationE484KAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(Δ71)-mCherry
Plasmid#92425PurposeExpression of fusion incompetent VAMP3 (del71) C-terminally conjugated to mCherry.DepositorInsertVAMP3 (Vamp3 Mouse)
TagsmCherryExpressionMammalianMutationdeleted leucine 71PromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 VAMP2 R125TAG
Plasmid#69876Purposeexpress in mammalian cells for unnatural amino acid incorporation into VAMP2-GFPDepositorInsertVAMP2-GFP (Vamp2 Rat)
UseSynthetic BiologyTagsGFPExpressionMammalianMutationAmber stop codon in the linker between VAMP2 and …Available SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-hMSN
Plasmid#211823PurposeExpress human MSN in mammalian cellsDepositorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAVA-Gal11p-LGF2(fs)
Plasmid#127482PurposeNegative control for the AVA-seq system. Gal11p (lambda CI associated) and LGF2 (with one nucleotide insertion) (RNAp associated) interactionDepositorInsertGal11p-LGF2(frame shifted) (GAL11 Budding Yeast)
ExpressionBacterialMutationLGF2 is frame shifted by the insert of one nucleo…Available SinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_GP1Fc Cl13
Plasmid#138599PurposeExpresses GP1 of LCMV Cl13 fused with human IgG (Fc fusion)DepositorInsertLCMV GP1-Fc
TagsFc fusion proteinExpressionMammalianPromoterCMVAvailable SinceApril 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
tdEos-Vimentin-7
Plasmid#57688PurposeLocalization: Intermediate Filaments, Excitation: 505 / 569, Emission: 516 / 581DepositorAvailable SinceFeb. 5, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRK5-myc-Miro2 R425V
Plasmid#47898PurposeExpresses myc tagged Miro2 R425V constitutively active mutantDepositorInsertMiro2 R425V (RHOT2 Human)
TagsmycExpressionMammalianMutationR425V, constitutively active mutantPromoterCMVAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEMS2112
Plasmid#49137PurposeAAV plasmid with NR2E1 (Ple264) promoter driving expression of EmGFP.DepositorInsertssAAV-Ple264-emGFP
UseAAVExpressionMammalianPromoterNR2E1Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFUSEss-CHIg-mG1_Arg322Lys
Plasmid#105849PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Arg322Lys (EU numbering).DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationArg322Lys in constant region of IgG1 heavy chainPromoterhEF1-HTLVAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS2114
Plasmid#49139PurposeAAV plasmid with FEV (Ple67) promoter driving expression of EmGFP.DepositorInsertssAAV-Ple67-emGFP
UseAAVExpressionMammalianPromoterFEVAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5FRT/Flag-hINO80N2 (1-406)
Plasmid#29442DepositorAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
Nsp14D-mCherry
Plasmid#165139Purposemammalian expression and localizationDepositorAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
Nsp4 deltaC-EGFP
Plasmid#165126Purposemammalian expression and localizationDepositorAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
nes1852tk/lacZ
Plasmid#47613Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation2nd intron onlyPromoterHSV tk promoterAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_1
Plasmid#155059PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SRGAP2A-FBAR-mRFP
Plasmid#168502PurposeExpression of the F-BAR domain (aa1-501) of SRGAP2 with a C-terminal mRFP fusion.DepositorAvailable SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only