We narrowed to 24,316 results for: crispr
-
Plasmid#75497Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-ER50-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187948PurposeER50 degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertER50-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianMutation6 mutations, T371A, L384M, M421G, G521R, Y537S, N…Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001146855)
Plasmid#77886Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001145663)
Plasmid#76361Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-ecDHFR-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187950PurposeecDHFR degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertecDHFR-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162242)
Plasmid#77099Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP305-pAAV-EFS-dSaCas9-KRAB-pA
Plasmid#113681PurposeA EFS driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001145637)
Plasmid#77887Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK7 gRNA (BRDN0001162196)
Plasmid#77740Purpose3rd generation lentiviral gRNA plasmid targeting human NEK7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2
Plasmid#176252PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene of N. oceanica IMET1 separated by fullDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001148103)
Plasmid#75498Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162291)
Plasmid#77097Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162239)
Plasmid#77098Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB_EF1a-CasRx-msfGFP-2A-Blast
Plasmid#226010PurposeCasRx protein for RNA targeting in piggyBac backboneDepositorInsertCasRx RNA-targeting nuclease
UseCRISPRTagsmsfGFPExpressionMammalianAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2B gRNA (BRDN0001145952)
Plasmid#76714Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001146004)
Plasmid#80174Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP303-pAAV-CMV-dSaCas9-VP64-pA
Plasmid#113678PurposeA CMV driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA2 gRNA (BRDN0001148851)
Plasmid#75734Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only