We narrowed to 912 results for: Gcat
-
Plasmid#227465Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 33kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-26kb-USP
Plasmid#227444Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 26kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-24kb-USP
Plasmid#227445Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 24kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circNUDC_1
Plasmid#215232PurposeSupression of shcircNUDC(5,RI,6)_1 expressionDepositorInsertcircNUDC shRNA 1 (NUDC Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
PE-pegRNA(BG)-nsgRNA(BG)
Plasmid#232727PurposeA dual-targeting vector that contains PE3 system guide RNAs against BFP (pegRNA(BG) and nsgRNA(BG)) with restriction enzyme sites for insertion of target site guide RNAS (pegRNAs(TS) and nsgRNA(TS)).DepositorInsertpegRNA(BG), nsgRNA(BG), pegRNAs(TS), nsgRNA(TS)
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-MAP4
Plasmid#227295PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of MAP4 for knock-in.DepositorAvailable SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 ANXA2 g2
Plasmid#170827PurposePiggyBac Cas13d sgRNA plasmid for ANXA2 knockdownDepositorInsertCas13d ANXA2 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA390
Plasmid#215957PurposeFragmid fragment: (guide cassette) guide expression; positive control reporterDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgEGFP_v1 [Sp]; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA232
Plasmid#215940PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surface with 2xPP7 & 2xMS2 in trRNADepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v4 [Sp]; trRNA_v14 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA238
Plasmid#215942PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v4 [Sp]; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-RPE_sgRNA2
Plasmid#201619PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertRPE (RPE Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#1
Plasmid#197424Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #1 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
ExpressionMammalianAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#2
Plasmid#197425Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #2 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
ExpressionMammalianAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-NDUFB5_sgRNA2
Plasmid#201607PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertNDUFB5 (NDUFB5 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA17
Plasmid#199589PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mNudcd3 - 1
Plasmid#198501Purposelentiviral stable expression of mNudcd3 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-3
Plasmid#124476PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-3_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E2-4
Plasmid#124477PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E2-4_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only