We narrowed to 562 results for: Tore
-
Plasmid#164427PurposeAAV plasmid expressing TGFB1 in photoreceptorsDepositorAvailable SinceNov. 20, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pCMV-myc-Atg5
Plasmid#24922DepositorAvailable SinceJune 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
AAV-hRedOpsin-mCherry
Plasmid#164426PurposeAAV plasmid expressing mCherry in photoreceptorsDepositorInsertmCherry
UseAAVExpressionMammalianPromoterhuman red opsinAvailable SinceNov. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-Txnip(C247S)
Plasmid#206341PurposeAAV plasmid expressing mutant TXNIP in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-nt.Txnip(C247S)(1-301aa)
Plasmid#206354PurposeAAV plasmid expressing deltion and mutant TXNIP in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
GST-prRDH-CTS
Plasmid#86069PurposeA bacterial expression plasmid encoding photoreceptor retinol dehydrogenase ciliary targeting signal with N-terminus GST-tag.DepositorInsertRetinol dehydrogenase (RDH8 Bovine)
TagsGSTExpressionBacterialMutationthe insert is 297-312 of RDH8 (Bos taurus)PromotertacAvailable SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
OpenLoopControl
Plasmid#59895Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Does not contain the target containing Vamp3 3′UTRDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPESTExpressionMammalianPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N3-TPC2
Plasmid#80153PurposeIntracellular Ca2+ store markerDepositorAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-LC3 (human)
Plasmid#24920PurposeMammalian expression of LC3 fused to EGFPDepositorAvailable SinceJune 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-LC3 (Atg8)
Plasmid#24919DepositorAvailable SinceJune 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-RPE65
Plasmid#206346PurposeAAV plasmid expressing RPE65 in photoreceptorsDepositorInsertRpe65 (Rpe65 Mouse)
UseAAVMutation450-Met (C57BL6 natural variation)Promoter1.7kb human red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
hEGFR-mEGFP
Plasmid#182878PurposeMammalian expression of epidermal growth factor receptor (EGFR) fused to mEGFPDepositorInserthEGFR-mEGFP (EGFR Human)
ExpressionMammalianAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-Lrat
Plasmid#206345PurposeAAV plasmid expressing LRAT in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgFFL
Plasmid#59877Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene.DepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1-MBP-NAAEF-PNR(217-410 C275)-His6
Plasmid#177849PurposeBacterial Expression of PNRDepositorInsertphotoreceptor cell-specific nuclear receptor (NR2E3 Human)
Tags6xHis and MBPExpressionBacterialAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR
Plasmid#164569PurposeSARS-CoV-2 Spike protein with Furin site restored (S-RRAR variant)DepositorInsertSpike (S-RRAR variant)
Tags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT2/CMV-eGFP.PB/PTK
Plasmid#170540PurposeExpresses the puromycin resistance gene fused to a thymidine kinase, upon excision of this cassette the reading frame of eGFP is restoredDepositorInsertDelta 5'-eGFP CMV-PuroTK- Delta 3'-eGFP
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_3x_siRNA
Plasmid#59893Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with three siRNA-like sitesDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--has three siRNA-like targets (fully c…Promoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-Hsp90ab1-FLAG
Plasmid#206355PurposeAAV plasmid expressing FLAG-tagged HSP90AB1 in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only