We narrowed to 9,802 results for: CAG
-
Plasmid#76799Purpose3rd generation lentiviral gRNA plasmid targeting human STK17BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
TESK2 gRNA (BRDN0001149439)
Plasmid#76435Purpose3rd generation lentiviral gRNA plasmid targeting human TESK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NAGK gRNA (BRDN0001146760)
Plasmid#76325Purpose3rd generation lentiviral gRNA plasmid targeting human NAGKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME6 gRNA (BRDN0001146177)
Plasmid#76223Purpose3rd generation lentiviral gRNA plasmid targeting human NME6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PASK gRNA (BRDN0001149035)
Plasmid#76204Purpose3rd generation lentiviral gRNA plasmid targeting human PASKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5KL1 gRNA (BRDN0001145139)
Plasmid#75822Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5KL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
VRK3 gRNA (BRDN0001148188)
Plasmid#75552Purpose3rd generation lentiviral gRNA plasmid targeting human VRK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MKNK1 gRNA (BRDN0001146808)
Plasmid#75512Purpose3rd generation lentiviral gRNA plasmid targeting human MKNK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NLK gRNA (BRDN0001147584)
Plasmid#75482Purpose3rd generation lentiviral gRNA plasmid targeting human NLKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MYO3B gRNA (BRDN0001145445)
Plasmid#75569Purpose3rd generation lentiviral gRNA plasmid targeting human MYO3BDepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-puro/hFOXH1 shRNA6
Plasmid#59310PurposeKnockdown of human FOXH1DepositorAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-camk2a
Plasmid#104589PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse camk2aDepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterNoneAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
LV-indLS2
Plasmid#123068PurposeLentiviral construct that delivers a tamoxifen inducible Cre. Upon recombination, luc2 and mStrawberry express. Used to image spontaneous tumorigenesis or subclonal cell populations in vivo.DepositorInsertsCreERT2 with intron
Firefly luciferase
mStrawberry
UseLentiviral and Luciferase; FluorescenceExpressionMammalianMutationsynthetic intron added as indicatedPromoterCAGGS (after Cre mediated inversion) and CAGGS (f…Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mouse cGAS #2-gRNA-Cas9-Puro
Plasmid#186891PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-PDL1
Plasmid#159280PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven human PDL1/CD274 (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.DepositorInsertHuman PDL1/CD274 (CD274 Human)
UseAAV; S1 knockin donor vectorExpressionMammalianPromoterCAGGSAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #2
Plasmid#136585PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV2 for Split-PE, gRNAs + MMLV-RT(dRH)-P2A-eGFP (PKC1002)
Plasmid#190112PurposeAAV2 for expression of pegRNA and ngRNA (HEKs3, CTT insertion) + MMLV-RT(dRH)-P2A-eGFPDepositorInsertsMMLV-RT(dRH)
U6-pegRNA(HEKs3, CTT ins)-H1-ngRNA(HEK s3)
UseAAVTagsbpNLS and bpNLS-P2A-eGFPMutationmutations from RT in PE2 and truncation of RNAse …PromoterEFS and U6, H1Available SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
MtPT4-p3
Plasmid#160003PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the MtPT4 promoter for visualisation of arbuscular mycorrhizal colonisation in Medicago truncatula roots.DepositorInsertsDsRed (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
ExpressionPlantPromoterArabidopsis thaliana Ubiquitin 10 Promoter (AtUb1…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only