We narrowed to 5,974 results for: SPI
-
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 2573
Plasmid#107233PurposeshRNA 2573. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 1122
Plasmid#107232PurposeshRNA 1122. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-FOXC1-WT
Plasmid#194566PurposeMammalian Expression of mEGFP-FOXC1 WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-WT-Full-length
Plasmid#194548PurposeMammalian Expression of mEGFP-HMGB1 WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-CALR-WT
Plasmid#194578PurposeMammalian Expression of mEGFP-CALR WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-45b-mEGFP-HMGB1-WT
Plasmid#194543PurposeBacterial Expression of 6xHis mEGFP-HMGB1 WT Fusion ProteinDepositorAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-FOXL2-WT
Plasmid#194584PurposeMammalian Expression of mEGFP-FOXL2 WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-WT-IDR
Plasmid#194549PurposeMammalian Expression of mEGFP-HMGB1 WT IDR Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-DVL1-WT
Plasmid#194586PurposeMammalian Expression of mEGFP-DVL1 WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-AVI
Plasmid#160476PurposeExpresses SARS-CoV-2 RBD domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD
TagsAVI, HRV3C, and scFcExpressionMammalianAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-AVI
Plasmid#160475PurposeExpresses SARS-CoV-2 NTD domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD
TagsAVI, HRV3C, and scFcExpressionMammalianAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
delta PE OCT4-GFP-2A-PURO transgenic reporter
Plasmid#52380PurposeBAC recombineering generated construct, used as a reporter for OCT4 expressionDepositorInsertsExpressionMammalianMutationdeleted -1620 - -1011 upstream from OCT4 ATGAvailable SinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-RUNX1-WT
Plasmid#194574PurposeMammalian Expression of mEGFP-RUNX1 WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-AVI
Plasmid#160477PurposeExpresses SARS-CoV-2 RBD-SD1 domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1
TagsAVI, HRV3C, and scFcExpressionMammalianAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
mouse deltaPE Oct4-GFP transgenic reporter
Plasmid#52382PurposeBAC recombineering generated construct, used as a reporter for mouse Oct4 expressionDepositorInsertsExpressionMammalianMutationdeleted -300 - -1300bp fragment upstream from Oct…PromoterOct4 and PGK+gb2Available SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only