We narrowed to 1,648 results for: cag promoter
-
Plasmid#70661PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against AAVS1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shTRAF2#1
Plasmid#44127DepositorInsertTRAF2 (TRAF2 Human)
UseLentiviral and RNAiAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shTRAF2#2
Plasmid#44128DepositorInsertTRAF2 (TRAF2 Human)
UseLentiviral and RNAiAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBT009.119.DA9
Plasmid#206803PurposeExpresses DA9 scRNA for activation of pDA303DepositorInsertDA9 scRNA
PromoterJ23119Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-RtcAshRNA1
Plasmid#126613PurposeExpresses shRNA against human RtcA under mouse U6 promoterDepositorInsertRtcA shRNA-1
UseRNAiPromotermouse U6 promoterAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-RtcAshRNA2
Plasmid#126614PurposeExpresses shRNA against human RtcA under mouse U6 promoterDepositorInsertRtcA shRNA-2
UseRNAiPromoterMouse U6 promoterAvailable SinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 Alk.2 shRNA
Plasmid#59297PurposeshRNA to mouse AlkDepositorInsertAlk.2 shRNA
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromotermouse U6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EP400
Plasmid#226449PurposeFor subcloning of human EP400 promoter or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Gg 3kb Green opsin GFP
Plasmid#72919Purposegreen opsin promoter from chicken (Gallus gallus) gDNA chr26:4,504,913–4,501,931 in galGal4 driving GFPDepositorInsertchicken green opsin promoter
Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSuper-Rem2-2
Plasmid#51595PurposeshRNA 2 against rodent Rem2DepositorAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
hIRF-1 gRNA #409 (Sa)
Plasmid#98134PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 systemDepositorInsertgRNA_hIRF1 promoter #409
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
hIRF-1 gRNA #351 (Sa)
Plasmid#105283PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 systemDepositorInsertgRNA_hIRF1 promoter #351
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
Gg 3kb Green opsin DsRed
Plasmid#72918Purposegreen opsin promoter from chicken (Gallus gallus) gDNA chr26:4,504,913–4,501,931 in galGal4 driving DsRedDepositorInsertchicken green opsin promoter
Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA-puro
Plasmid#180426PurposeExpresses puromycin resistance gene and scrambled gRNA for stable integration in mammalian cells; useful as control and template for new gRNAs by mutagenesis.DepositorInsertgRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuideFUT3-neo
Plasmid#250304PurposeEncodes gRNA targeting FUT3DepositorAvailable SinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
LRG/Foxa1 e2.4
Plasmid#105511PurposeLentiviral expression of Foxa1 DNA-binding domain (exon 2) targeting sgRNADepositorInsertFoxa1 (sgRNA, e2.4)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4405
Plasmid#115466PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRG/Rosa26
Plasmid#105510PurposeLentiviral expression of Rosa26 targeting sgRNADepositorInsertRosa26 (Gt(ROSA)26Sor Mouse)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL3-9465
Plasmid#115464PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh1
Plasmid#127650PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
shERK2a-mlpx-puro
Plasmid#65229Purposeencodes a shRNA against ERK2DepositorInsertshRNA against ERK2 (MAPK1 Human)
ExpressionMammalianAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330 p300 gRNA
Plasmid#165591PurposeInsertion of p300 degronDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
lentiCRISPR - DDX3Y sgRNA 1
Plasmid#70656PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX198
Plasmid#89262PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01DepositorInsertOsPDS-gRNA01
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 1
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 2
Plasmid#70654PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX203
Plasmid#89267PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsDEP1 gene, OsDEP1-gRNA02DepositorInsertOsDEP1-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgAAVS1-HepmTurquoise2
Plasmid#192828PurposeExpresses sgRNA targeting AAVS1 (non-targeting control sgRNA for mouse) and mTurquoise2 from hepatocyte-specific promoterDepositorInsertmTurquoise2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCS-rybozyme-IRES-CAS9
Plasmid#64668PurposePlasmid encoding multiple cloning site, rybozyme and IRES-CAS9.DepositorInsertsCAS9
HDV ribozyme
UseCRISPRTagsFlag, Internal ribosome entry site, and guide RNA…ExpressionMammalianAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgAAVS1-HepmCherry
Plasmid#192827PurposeExpresses sgRNA targeting AAVS1 (non-targeting control sgRNA for mouse) and mCherry from hepatocyte-specific promoterDepositorInsertmCherry
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(A)
Plasmid#236038PurposeThe plasmid pQdCas12a.sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (A) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-empty-GFP
Plasmid#221843Purposeempty vector to clone custom sgRNA into BsaI sites to express sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertEGFP
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGCAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-DNM1L -GFP
Plasmid#221845PurposeTol2 transposon expressing sgRNA targeting chick DNM1L from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
DNM1L sgRNA-gTGTTTTCCGACCATCCTCTG
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGC and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-MFN1-GFP
Plasmid#221846PurposeTol2 transposon expressing sgRNA targeting chick MFN1 from chick U6.3 promoter expresses GFP reporter from GAGC promoteDepositorInsertsEGFP
MFN1 sgRNA-GAGAAGAAGAGCGTCAAGGT
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGC and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pClgn-Tesmin-BioID2-3xFLAG
Plasmid#186816PurposeMouse Clgn promoter-driven expression of TESMIN-BioID2-3xFLAGDepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pClgn-Tesmin-TurboID-3xFLAG
Plasmid#186817PurposeMouse Clgn promoter-driven expression of TESMIN-TurboID-3xFLAGDepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ac 1.8kb red opsin GFP.
Plasmid#72915Purposered opsin promoter from Carolina anole lizard (Anolis carolinensis) gDNA (nucleotides21,797 to 187, corresponding to chr2:88663108–88664997 in anoCar2.0) driving GFPDepositorInsertred opsin promoter
Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only