We narrowed to 21,206 results for: ACE;
-
Plasmid#191349PurposeClostridium expression vector (pCB102 origin, specR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
BL21 Rosetta2 ΔrecBCD GamS
Bacterial Strain#176586PurposeE. coli BL21 strain (with recBCD genomic locus deleted) for making cell-free extracts for Linear DNA expression. Contains pRARE2 + pBADmod1-linker2-gamS plasmids.DepositorBacterial ResistanceChloramphenicol and AmpicillinAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
BL21 Rosetta2 ΔrecB GamS
Bacterial Strain#176585PurposeE. coli BL21 strain (with recB genomic locus deleted) for making cell-free extracts for Linear DNA expression. Contains pRARE2 + pBADmod1-linker2-gamS plasmids.DepositorBacterial ResistanceChloramphenicol and AmpicillinAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(+36)-DL4
Plasmid#199168Purposeused to express a supercharged GFP variant that forms inclusion bodies in E. coliDepositorInsertGFP(+36)-DL4
TagsMGHHHHHHGGAMutationE16R, T19R, V21K, D29K, E42K, E44K, N49E, D86K, Q…PromoterT7Available SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPTK021-7-PARS
Plasmid#84990PurposeType 7, Pichia autonomously replicating sequenceDepositorInsertPichia autonomously replicating sequence
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK005-3a-αMF
Plasmid#84964PurposeType 3a, α-mating factor - secretion signalDepositorInsertα-mating factor secretion tag
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK020-7-attB
Plasmid#84989PurposeType 7, BxbI recognition siteDepositorInsertBxbI recognition site
UseSynthetic BiologyExpressionYeastMutationBsaI site removed (1711 t to a)PromoterNonAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK017-3b-yEGFP_Sec
Plasmid#84976PurposeType 3b, Green fluorescent proteinDepositorInsertGreen fluorescent protein
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK015-3-yEGFP_Intra
Plasmid#84974PurposeType 3, Green fluorescent proteinDepositorInsertGreen fluorescent protein
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK019-4-tAOX1
Plasmid#84988PurposeType 4, tAOX, Alcohol oxidase 1 terminatorDepositorInsertAlcohol oxidase 1 terminator
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pPTK004-2-pTPI1
Plasmid#84963PurposeType 2, pTPI1, Triose phosphate isomerase 1 promoterDepositorInsertTriose phosphate isomerase 1 promoter
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK009-3a-αAmylase-αMFΔ
Plasmid#84968PurposeType 3a, α-Amylase followed by αMFΔ - secretion signalDepositorInsertα-Amylase followed by MFΔ secretion tag
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK010-3a-Glucoamylase-αMFΔ
Plasmid#84969PurposeType 3a, Glucoamylase followed by αMFΔ - secretion signalDepositorInsertGlucoamylase followed by αMFΔ secretion tag
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK006-3a-αMF no EAEA
Plasmid#84965PurposeType 3a, α-mating factor no EAEA - secretion signalDepositorInsertα-mating factor no EAEA secretion tag
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK018-3b-RFP_Sec
Plasmid#84977PurposeType 3b, Red fluorescent proteinDepositorInsertRed fluorescent protein
UseSynthetic BiologyExpressionYeastMutationBsaI site removed (1677 c to g and 1794 a to g)PromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK001-2-pAOX1
Plasmid#84960PurposeType 2, pAOX1, Alcohol oxidase 1 promoterDepositorInsertAlcohol oxidase 1 promoter
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK013-3a-Invertase-αMFΔ
Plasmid#84972PurposeType 3a, Invertase followed by αMFΔ - secretion signalDepositorInsertInvertase followed by αMFΔ secretion tag
UseSynthetic BiologyExpressionYeastPromoterNonAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only