We narrowed to 11,733 results for: aga
-
Plasmid#210013Purposeknock out BAX in mammalian cellsDepositorInsertApoptosis regulator BAX (BAX Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFB-GST-IRP2
Plasmid#226621PurposeExpresses human IRP2 in insect cellsDepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Foxo1-ADA 6KQ
Plasmid#17563DepositorInsertFoxo1 ADA 6KQ (Foxo1 Mouse)
TagsFlag and MycExpressionMammalianMutationK242, K245, K259, K262, K271 and K291 were replac…PromoterCMVAvailable SinceOct. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCOTS-pyl-GFP(35TAG)
Plasmid#92047PurposeThis is a S. elongatus (PCC7942) cyanobacterial plasmid that encodes the pylRS orthogonal translation system. In addition it encodes for a GFP reporter with TAG mutation at site 35.DepositorInsertsEGFP
Pyrrolysyl tRNA(cua)
Pyrrolysyl tRNA synthetase (methanosarcina mazei)
UseReplicative expression plasmid for cyanobacteria …TagsHistagMutationTyrosine in position 35 of the GFP was mutated f…PromoterLeuP (native S. elongatus promoter), PpsbII, and …Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-eEF2K(S441A/S445A)
Plasmid#110161PurposeExpression of human eEF2K (S441A/S445A) in mammalian cellsDepositorInserteEF2K (eukaryotic elongation factor 2 kinase) (EEF2K Human)
TagsHAExpressionMammalianMutationS441A/S445APromoterCMVAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-StrepTagII-HA
Plasmid#162100PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-StrepTagII-HA
UseLentiviralTagsVSVg-StrepTagII-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-TM-Kv2.1-CaM-NES-TevN-AsLOV2-TEVseq-tTA
Plasmid#171618PurposeAAV Soma-targeted Cal-Light with Kv2.1DepositorInsertTM-Kv2.1-CaM-NES-TevN-AsLOV2-TEVseq-tTA
UseAAV and Synthetic BiologyTagsMycExpressionMammalianPromoterCMVAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+) NRP1 b1b2 (273-586)
Plasmid#162733PurposeBacterial expression the b1b2 tandem domains from the rat Neuropilin 1 receptor (NRP1). With an N-terminal 6His tag and thrombin cleavage site.DepositorInsertHuman NRP1 b1b2 domains (residues 273-586)
Tags6HisExpressionBacterialMutationCodon optimisedAvailable SinceMarch 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
SPDK3889(TRV-RNA2-pPEBV-MCS-AtMet-tRNA)
Plasmid#149277PurposeModified Tobacco rattle virus RNA2 vector that could be used for expression of sgRNAsDepositorInsertModified TRV RNA2 with PEBV promoter and AtMet-tRNA mobile RNA sequence
UseT-dna vectorMutationT2318C (DNA) in PEBV coat protein sequenceAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-IKZF1-sh2
Plasmid#69041Purpose3rd generation lentiviral vector expressing IKZF1 shRNADepositorAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PM2-FRB-CFP
Plasmid#67518PurposeFRB conjugated plasma membrane targeting sequences 2 from Lyn11(GCIKSKGKDSA)DepositorInsertmTOR (MTOR Human)
TagsCFP, HA, and PM tethering sequence from human Lyn…ExpressionMammalianMutationFRB domain only (residues 2019–2114)PromoterCMVAvailable SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Rims2-GFP KI
Plasmid#131495PurposeEndogenous tagging of RIM2: C-terminal (amino acid position: S1551)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
mChF-AIP(TA)
Plasmid#61528PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry and AIP (with TA mutation)DepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP with TA mutation (see comments) and mCherryExpressionMammalianPromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_IFIT2
Plasmid#99321PurposeLuciferase validation vector with IFIT2 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr10: 91060605-91062447
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY036_ATP1A1_G5_Array
Plasmid#86620PurposeVector for expression of a CRISPR/AsCpf1 array containing the ATP1A1 G5 guide in combination with a user-specified guide. Cloning of oligos for the second guide using BbsI sites. PY036-like plasmidDepositorInsertATP1A1 G5 crRNA + user-specified crRNA + AsCpf1-3xHA
UseCRISPR; Co-selection via hdr using ouabainTags3xHAExpressionMammalianPromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-ProtC-HA
Plasmid#162109PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-ProtC-HA
UseLentiviralTagsStrepTagII-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_MX1
Plasmid#99323PurposeLuciferase validation vector with MX1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr21: 42791443 -42793515
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-ProtC-HA
Plasmid#162103PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-ProtC-HA
UseLentiviralTagsVSVg-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only