We narrowed to 4,323 results for: Mcc;
-
Plasmid#200027PurposeLentiviral vector for expression of KSHV ORF29 with D476A mutationDepositorInsertORF29
UseLentiviralMutationAspartic acid 476 changed to AlaninePromoterCMVAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
StrKDEL-IRES-ManII-mScarlet-i
Plasmid#117274PurposeExpresses an Str-KDEL Hook for the RUSH system and separately mannosidase II-mScarlet-iDepositorInsertsTagsmScarlet-iExpressionMammalianMutationcontains only amino acids 1 to 116 of ManIIPromoterCMV and IRESAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA hUbC-VP64-dSaCas9-VP64-T2A-Thy1.1
Plasmid#194279PurposeExpresses gRNA and VP64-dSaCas9-VP64 from lentiviral vectorDepositorInsertshumanized VP64 dSaCas9 VP64 T2A Thy1.1
gRNA
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhU6 and hUbCAvailable SinceFeb. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
GST-CHMP4C (216-233) (pGEX2T(TEV))
Plasmid#80635PurposeResidues 216-233 of CHMP4C; Bacterial Expression Vector; TEV-cleavable GST tag; Sundquist Lab Internal ID: WISP06-202DepositorAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
GST-CHMP4A (205-222) (pGEX2T(TEV))
Plasmid#80633PurposeResidues 205-222 of CHMP4A, Bacterial Expression Vector; TEV-cleavable GST tag; Sundquist Lab Internal ID: WISP06-60DepositorAvailable SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSCGB3A2_HL-P2A-TagBFP-PGK-NeoR-SCGB3A2_HR
Plasmid#126697Purposedonor vector for targeting a 2A peptide followed by blue fluorescent reporter to the human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertTagBFP
ExpressionMammalianAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-RFP657-CASP8
Plasmid#75164PurposeLentiCRISPR-RFP657 with sgRNA targeting human Caspase-8DepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA2-Cul4A-deltaROC
Plasmid#20713DepositorInsertCullin 4A (CUL4A Human)
TagsHA2ExpressionMammalianMutationDeletion of residues 594 to 612 from N-terminusAvailable SinceMay 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
GST-CHMP4B (205-224) (pGEX2T(TEV))
Plasmid#80634PurposeResidues 205-224 of CHMP4B, Bacterial Expression Vector; TEV-cleavabel GST tag; Sundquist Lab Internal ID: WISP06-201DepositorAvailable SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
GST-CHMP4A (205-222) E209A (pGEX2T(TEV))
Plasmid#80640PurposeResidues 205-222 of CHMP4A, Mutation modestly disrupts binding to ALIX; Bacterial Expression Vector; TEV-cleavable GST-tag; Sundquist Lab Internal ID: WISP06-206DepositorInsertCHMP4A (CHMP4A Human)
TagsGSTExpressionBacterialMutationChanged Glutamate 209 to alanineAvailable SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
GST-CHMP4A (205-222) L217A (pGEX2T(TEV))
Plasmid#80638PurposeResidues 205-222 of CHMP4A, Mutation disrupts binding to ALIX; Bacterial Expression Vector; TEV-cleavable GST-tag; Sundquist Lab Internal ID: WISP06-204DepositorInsertCHMP4A (CHMP4A Human)
TagsGSTExpressionBacterialMutationResidues 205-222; Changed Leucine 217 to AlanineAvailable SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
GST-CHMP4A (205-222) W220A (pGEX2T(TEV))
Plasmid#80637PurposeResidues 205-222 of CHMP4A, Mutation disrupts binding to ALIX; Bacterial Expression Vector; TEV-cleavable GST-tag; Sundquist Lab Internal ID: WISP06-203DepositorInsertCHMP4A (CHMP4A Human)
TagsGSTExpressionBacterialMutationResidues 205-222; Changed Trp 220 to AlaAvailable SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
GST-CHMP4A (205-222) L214A (pGEX2T(TEV))
Plasmid#80639PurposeResidues 205-222 of CHMP4A, Mutation disrupts binding to ALIX; Bacterial Expression Vector; TEV-cleavable GST-tag; Sundquist Lab Internal ID: WISP06-205DepositorInsertCHMP4A (CHMP4A Human)
TagsGSTExpressionBacterialMutationResidues 205-222; Changed Leucine 214 to AlanineAvailable SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
MCS-3_Endofin_LgBiT
Plasmid#182574PurposeThis plasmid can be used to monitor receptor internalization in real time living cells using bioluminescence as a readout.DepositorInsertzinc finger FYVE-type (ZFYVE16 Human)
TagsLgBiT (Large BiT)ExpressionMammalianMutationFYVE domain Q739-K806PromoterHerpes simplex virus (HSV)Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLC-BFP-FADD
Plasmid#75166PurposeLentiCRISPR-BFP with sgRNA targeting human FADDDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
StrKDEL-IRES-mannosidase II-mTagBFP2
Plasmid#165460PurposeExpressed mannII-BFP simultaneously with a RUSH Hook Str-KDEL.DepositorInsertPartial ManII-mTag2BFP fusion (Man2a1 Mouse)
TagsStr-KDEL and mTag2BFPExpressionMammalianMutationcontains only amino acids 1 to 116 of ManIIPromoterCMVAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCENPTΔC-dCas9-3xGFP
Plasmid#198325PurposeExpresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locusDepositorInsertCENPTΔC (CENPT Human)
UseLentiviralTagsEGFP x 3 and dCas9ExpressionMammalianMutationtruncation - encodes only amino acids 1-375PromoterCMV-TetOAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1(-) mouse C/EBP delta
Plasmid#12559DepositorInsertCCAAT/Enhancer-binding Protein delta (Cebpd Mouse)
ExpressionMammalianMutationS2G introduced during cloningAvailable SinceJuly 18, 2007AvailabilityAcademic Institutions and Nonprofits only