We narrowed to 1,236 results for: poli
-
Plasmid#107582PurposeB. megaterium DSM319 fba promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic Biology; E. coli and bacillus shuttle v…TagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromoterfba promoter Bacillus megaterium DSM319Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3E-hGPR56 e1m promoter normal
Plasmid#52298PurposeReporter for normal human GPR56 exon 1m promoter activity. Human GPR56 e1m promoter (chr16:56,230,630-56,230,943 (hg18)) was inserted into pGL3E.DepositorInsertADGRG1 adhesion G protein-coupled receptor G1 (ADGRG1 Human)
UseLuciferaseAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-gap_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107577PurposeB. megaterium DSM319 gap promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic Biology; E. coli and bacillus shuttle v…TagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromotergapdh promoter - B. megaterium DSM319Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3E-hGPR56 e1m promoter perisylvian polymicrogyria
Plasmid#52299PurposeReporter for mutated human GPR56 exon 1m promoter activity. It contains a 15-bp deletion in a conserved noncoding element. The mutated human GPR56 e1m promoter was inserted into pGL3E.DepositorInsertADGRG1 adhesion G protein-coupled receptor G1 (ADGRG1 Human)
UseLuciferaseMutation15-bp deletion in the promoterPromoterHuman GPR56 e1m promoterAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
RALA V25L
Plasmid#122927PurposeBacterial expression of RALA V25LDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA V25M
Plasmid#122928PurposeBacterial expression of RALA V25MDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA D130G
Plasmid#122929PurposeBacterial expression of RALA D130GDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA S157A
Plasmid#122930PurposeBacterial expression of RALA S157ADepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA R176X
Plasmid#122931PurposeBacterial expression of RALA R176XDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA WT
Plasmid#122925PurposeBacterial expression of RALA WTDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA G23D
Plasmid#122926PurposeBacterial expression of RALA G23DDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core
Plasmid#61357Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHIS-MDH1-HIS
Plasmid#184558PurposeBacterial expression of human MDH1 with HIS TagDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD63-pHluorin
Plasmid#130901PurposeExpression of CD63-pHluorin for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD63-pHluorin (CD63 Human, Aequorea victoria)
TagspHluorinExpressionMammalianMutationpHluorin inserted between Gln-36 and Leu-37 in ex…PromoterCMVAvailable SinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (D1399Y)
Plasmid#61358Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutation D1399Y) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; D1399Y mutation i…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD81-pHluorin
Plasmid#130903PurposeExpression of CD81-pHluorin for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD81-pHluorin (CD81 Human, aequorea victoria)
TagspHluorinExpressionMammalianMutationpHluorin inserted between Leu-49 and Gly-50 in ex…PromoterCMVAvailable SinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 S HexaPro
Plasmid#154754PurposeMammalian expression vector for expression of the SARS-CoV-2 spike HexaPro variantDepositorInsertSpike (HexaPro variant) (S Severe acute respiratory syndrome coronavirus 2)
Tags2X Strep-Tag II, 8X His tag, and HRV 3C cleavage …ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceJuly 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-Sport6-CD9-pHluorin
Plasmid#130905PurposeExpression of CD9-pHluorin for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD9-pHluorin (CD9 Human, Aequorea victoria)
TagspHluorinExpressionMammalianMutationphluorin inserted between Asn-50 and Asn-51 in ex…PromoterCMVAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD63-pHuji
Plasmid#130902PurposeExpression of CD63-pHuji for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD63-pHuji (CD63 Human, synthetic)
TagspHujiExpressionMammalianMutationpHuji inserted between Gln-36 and Leu-37 in extra…PromoterCMVAvailable SinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (Y1467F)
Plasmid#61362Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inavtivating mutation Y1467F) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; Y1467F mutation i…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD81-pHuji
Plasmid#130904PurposeExpression of CD81-pHuji for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD81-pHuji (CD81 Human, Synthetic)
TagspHujiExpressionMammalianMutationpHuji inserted between Leu-49 and Gly-50 in extra…PromoterCMVAvailable SinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD9-pHuji
Plasmid#130906PurposeExpression of CD9-pHuji for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD9-pHuji (CD9 Human, Synthetic)
TagspHujiExpressionMammalianMutationpHuji inserted between Asn50 and Asn51 in extrace…PromoterCMVAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (1645/1646 RR/EE)
Plasmid#61359Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation 1645/1646 RR/EE) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; 1645/1646 RR/EE m…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (1396/1397 SY/WW)
Plasmid#61363Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutation 1396/1397 SY/WW) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; 1396/1397 SY/WW m…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (C1204R)
Plasmid#61361Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation C1204R) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; C1204R mutation i…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (H1415A/E1423A/Y1424A/L1428S/Y1430A/H1434A)
Plasmid#61364Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutations H1415A/E1423A/Y1424A/L1428S/Y1430A/H1434A) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; H1415A/E1423A/Y14…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUltra-MDH1-ME1
Plasmid#184465PurposeLentiviral vector for tri-cistronic expression of EGFP, MDH1 and ME1 (seperated by P2A and T2A)DepositorUseLentiviralTagsfused to T2AExpressionMammalianMutationdeletion of stop codonPromoterUbCAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLPC-puromycin-binary-MDH1-3xFLAG-ME1- HA
Plasmid#184549PurposeRetroviral vector to co-express human MDH1 with 3xFLAG tag and human ME1 with HA tagDepositorUseRetroviralTags3xFLAG and HA tagExpressionMammalianPromoterCMVAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ spike_del19
Plasmid#155297PurposeExpression of spike with C-term deletion of 19 aa, used to generate high efficiency SARS-CoV-2-pseudotyped lentiviral particlesDepositorInsertSARS-Cov2 spike_deleted (S SARS-Cov2)
UseGeneration of sars-cov-2-pseudotyped lentiviral p…MutationDeletion in C-term 19 aa of spikePromoterCMVAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
mCherry-PARP1
Plasmid#215136PurposeExpresses mCherry-PARP1 in mammalian cells from a retroviral vector.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-PARP1-del.p119K120S–eGFP
Plasmid#211554PurposeA piggyBac vector containing CMV-PARP1-del.p119K120S-eGFP-IRES-Neo cassette.DepositorInsertPARP1 (PARP1 Human)
UsePiggybacTagseGFPExpressionMammalianMutationdeletion of amino acids 119K 120SPromoterCMVAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-PARP1-delM43;F44I
Plasmid#211579PurposeCMV driven PARP1-delM43;F44I -eGFP expressing construct with IRES-Neomycin selectionDepositorInsertPARP1 (PARP1 Human)
TagseGFPExpressionMammalianMutationContains deletion of M43 and F44IAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shGFP
Plasmid#110419PurposeshGFP control, silence GFP gene, blasticidin selection.DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shGFP
Plasmid#110421PurposeshGFP control, silence GFP gene, doxycycline inducible, puromycin selectionDepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shLuc
Plasmid#110422PurposeshLuc control, silence Luc gene, doxycycline inducible, puromycin selectionDepositorInsertLuciferase
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS414-7x2-PHO5-GFP-hPLC delta PH domain dimer
Plasmid#58837PurposeExpresses GFP-Tagged Human PLC delta PH domain in yeastDepositorAvailable SinceSept. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSAV108
Plasmid#226323PurposeEmpty backbone plasmid for genomic insertions into H. neapolitanus neutral siteDepositorTypeEmpty backboneExpressionBacterialAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shLuc
Plasmid#110409PurposeshLuc (Target TTACGCTGAGTACTTCGA), silence LUC gene, blasticidin selection.DepositorInsertLuciferase
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shGAC
Plasmid#110423PurposeshGAC, silence glutaminase GAC isoform, doxycycline inducible, puromycin selectionDepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only