We narrowed to 16,162 results for: grna
- 
  Plasmid#132587PurposegRNA used for knockin NanoLuc and tdTomado (separated by 2A) into MYH11 allele (MYH11-NanoLuc-2A-tdTomato vector) )DepositorInsertMYH11-gRNA1
ExpressionBacterialAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only - 
  
LENTICRISPR-UPP1_sgRNA2
Plasmid#201635PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only - 
  
pU6a:sgRNA(tyr)
Plasmid#64250Purposeexpresses sgRNA(tyr) under U6a promoterDepositorInsertU6a:sgRNA (tyr)
UseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only - 
  
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only - 
  
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only - 
  
pPEPZ-sgRNAclone
Plasmid#141090PurposeThis vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.DepositorInsertmCherry
UseCRISPRExpressionBacterialPromoterp3Available SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only - 
  
pH-STEME-1-esgRNA
Plasmid#138135PurposeTargeted simultaneous C-to-T and A-to-G in riceDepositorInsertAPOBEC3A-wtTadA-TadA7.10-nCas9-UGI-NLS
ExpressionPlantAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only - 
  
KAT5 sgRNA1
Plasmid#138187Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only - 
  
KAT5 sgRNA2
Plasmid#138188Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only - 
  
pX459_gRNA-AAVS1_hspCas9
Plasmid#193309PurposeCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
LbCas12a-gRNA_BbsI_CAM
Plasmid#183222PurposeLbCas12a gRNA containing BbsI restriction recognition sites in spacer sequence for Golden Gate AssemblyDepositorInsertLbCas12a guide RNA containing BbsI sites in spacer sequence
UseCRISPRExpressionBacterialAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
HUWE1-sgRNA-1
Plasmid#86924PurposeTo express sgRNA target HUWE1 geneDepositorAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only - 
  
pSCB2-sgRNA
Plasmid#129463PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).DepositorInsertpgRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only - 
  
HUWE1-sgRNA-2
Plasmid#86925PurposeTo express sgRNA target HUWE1 geneDepositorAvailable SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only - 
  
Chr7_Centromere-Targeting_gRNA
Plasmid#195129Purposedual gRNA vector targeting centromere-proximal locations on Chromosome 7p and 7q in a third generation Cas9 backbone with GFPDepositorInsertChr7 gRNA
ExpressionMammalianAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
ULK1 sgRNA
Plasmid#207559PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorInsertCCAGCCAGGCCAGAAAGGTC
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
pTol2_LSEC:Cas9green; erbb2_gRNA171
Plasmid#199338PurposepDEL135; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous erbb2 sgRNADepositorInsertsLSEC
Cas9
erbb2 sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
pU6_rd12_pegRNA_(PP7-C4-Q1)
Plasmid#232435PurposepegRNA with optimized 3' modifications to correct the rd12 mutationDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only - 
  
pU6_rd12_nsgRNA(PP7)
Plasmid#232436PurposensgRNA for PE3b correction of the rd12 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only