We narrowed to 1,148 results for: ttl
-
Plasmid#159077PurposeT7 expression of C-term fluorescent fusion in E. coliDepositorInsertMSMEG_0709
UseIntegrating mycobacterial expression vector attl5TagsGly-Ala Linker/Dendra2/1x Flag TagExpressionBacterialPromoterpmycTetOAvailable sinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-muSOX
Plasmid#131701Purposeexpresses muSOX with GFP N-terminally fusedDepositorAvailable sinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBUN250
Plasmid#60672Purposeoverexpression of M. smegmatis ddl gene in MycobacteriumDepositorInsertddl
UseE.coli-mycobacterium shuttle vectorPromoterBCG Hsp60Available sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pdest WDR4 Puro
Plasmid#223062PurposeWDR4 gene expression in mammalian cellsDepositorAvailable sinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS405-LEU2-TEF-KpolDcr1v2
Plasmid#85193PurposeIntegrating plasmid, K. polysporus Dcr1 under TEF promoterDepositorInsertDcr1
UseIntegrating, shuttle vectorExpressionYeastPromoterTEFAvailable sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJJH1307
Plasmid#36910DepositorInsertScLEU2
UseLentiviralExpressionBacterial, Mammalian, and Y…Available sinceJuly 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pdest EGFP Neo
Plasmid#223052PurposeEGFP gene expression in mammalian cellsDepositorInsertEGFP
UseLentiviralExpressionMammalianPromoterCMVAvailable sinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDGE7
Plasmid#79462PurposesgRNA shuttle vector; module 2DepositorInsertpAtU6-ccdB-sgRNA (ccdB(letD) )
UseCRISPR and Synthetic BiologyMutationBsaI site eliminatedAvailable sinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGE9
Plasmid#79465PurposesgRNA shuttle vector; module 3DepositorInsertpAtU6-ccdB-sgRNA (ccdB(letD) )
UseCRISPR and Synthetic BiologyMutationBsaI site eliminatedAvailable sinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGE11
Plasmid#79467PurposesgRNA shuttle vector; module 4EDepositorInsertpAtU6-ccdB-sgRNA (ccdB(letD) )
UseCRISPR and Synthetic BiologyMutationBsaI site eliminatedAvailable sinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
rag2:CPSF6_CE_pISceI
Plasmid#223037PurposeExpress CPSF6 gene in mesenchymal lineage of Zebrafish.DepositorAvailable sinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSUM-Kan-MCS2
Plasmid#109289PurposeExpresses high levels of protein in mycobacteriaDepositorTypeEmpty backboneExpressionBacterialMutationpSUM-kan-MCS1-gfp was modified to reorient the Ba…Available sinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
rag2:FRS2_CE_pISceI
Plasmid#223040PurposeExpress FRS2 gene in mesenchymal lineage of Zebrafish.DepositorAvailable sinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ef1a-QCP-3xBFP
Plasmid#158206PurposeQb coat protein fused to three repeats of the blue fluorescent protein under a Efla promoter.DepositorInsertQCP under the Elfa promoter and three BFP tags
UseSynthetic BiologyTags3xBFPExpressionMammalianPromoterElfaAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
IFITM3-N21del-V93-TAG
Plasmid#122480Purposeexpresses human IFITM3-N21del with unnatural amino acid incorporated site specifically in response to the amber codon TAG in mammalian cells when co-transfected with tRNA synthetase/tRNA pair.DepositorInsertIFITM3 (IFITM3 Human)
ExpressionMammalianMutationChanged Valine 93 to amber codon and deleted amin…Available sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOEM-GED-mCherry
Plasmid#102781PurposeBaculovirus rescue vector, VSVGED pseudotype, mCherryDepositorInsertmCherry
UseBaculoviral rescue shuttle vectorExpressionInsect and MammalianPromoterCMVAvailable sinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS1135
Plasmid#29055PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable sinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-3'UTR mouse Il13 5xBoxB
Plasmid#207128PurposeTethered luciferase reporter for mouse Il13 BoxBDepositorAvailable sinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-SERTG56A -myc
Plasmid#107459PurposeMammalian expression plasmid for codon optimized mutant hSERT with internal MYC tag inserted in ECL2, mutation G56A conferring wildtype phenotypeDepositorPublicationAvailable sinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only