We narrowed to 9,672 results for: Pol
-
-
-
pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP
Plasmid#71237PurposeExpress sgRNA and dCas9-KRAB from 3rd generation lentiviral vectorDepositorInsertshumanized dCas9-KRAB T2A GFP
sgRNA
UseCRISPR and LentiviralTagsFlagMutationD10A and H840AAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro
Plasmid#71236PurposeExpress sgRNA and dCas9-KRAB from lentiviral vectorDepositorInsertshumanized dCas9-KRAB T2A Puro
sgRNA
UseCRISPR and LentiviralTagsFlagMutationD10A and H840AAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
FUW mCherry-GFP-LC3
Plasmid#110060PurposeTo visualize free autophagosomes (GFP and mCherry fluorescence) and autophagosomes that have fused with the lysosome (autolyosomes; mCherry fluorescence only, due to acid sensitivity of GFP)DepositorInsertmCherry-GFP-LC3
UseLentiviralAvailable SinceMay 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-hTERT-IRES-hygro
Plasmid#85140PurposeLentiviral expression of hTERT, used to create immortalized cell linesDepositorAvailable SinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
T7opt in pCAGGS
Plasmid#65974PurposeHuman codon-optimized T7 polymeraseDepositorInsertT7-opt
ExpressionMammalianAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MCS-GFP-SV-puro
Plasmid#73582PurposeThird generation lentiviral vector expressing GFP and puromycinDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsGFP tagAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQFlag-USP7 WT puroR
Plasmid#46751PurposeRetroviral vector that expresses wild type Flag-tagged human USP7DepositorAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQFlag-USP7 CS puroR
Plasmid#46752PurposeRetroviral vector that expresses catalytically inactive form of Flag-tagged human USP7DepositorInsertUSP7 (USP7 Human)
UseRetroviralTagsFlagExpressionMammalianMutationC223S--catalytically inactivePromoterCMVAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDFDuet-nsp7-nsp8
Plasmid#159092PurposeCoexpression construct of Nsp7 with an N-terminal His-tag and Nsp8DepositorInsertsNSP7
NSP8
TagsHisExpressionBacterialPromoterT7Available SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458 V3
Plasmid#226957PurposeCBh-SpCas9-2A-GFP, and hU6-sgRNA (Sp) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_B
Plasmid#74375PurposegRNA_B to knockout human AMPK alpha 1 using Cas9nDepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_A
Plasmid#74374PurposegRNA_A to knockout human AMPK alpha 1 using Cas9nDepositorAvailable SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYES2/103Q
Plasmid#1385DepositorInserthuntingtin (103Q) (HTT Human)
TagsEGFP and FLAGExpressionYeastMutationExon1 sequences containing the first 17 amino aci…Available SinceFeb. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
CaV1.3e[8a,11,31b,Δ32,42a]
Plasmid#49333PurposeRepaired Addgene #26576 to agree with the rat ref sequence. Repairs are @: nt 3310 (GTG->GCG) [Val->Ala]; nt 731 (TCA->GGA) [Ser->Gly].DepositorInsertCACNA1D (Cacna1d Rat)
ExpressionMammalianMutationContains exons 8a, 11, 31b and 42a.Deletion of ex…PromoterCMVAvailable SinceFeb. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CiDr-VSP L223F-mCherry pcDNA3.1 (eVSP)
Plasmid#140892PurposeExpresses modified Danio rerio VSP without phosphatase activity (inactive mutant of enhanced VSP) fused with mCherry in mammalian cells.DepositorTagsmCherryExpressionMammalianMutationchanged 223L to F in Dr-VSP (zebrafish TPTE)Available SinceApril 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC
Plasmid#62806PurposeTo express genes at high levels in neuronal cells. This UbC promoter is more active in neurons than the promoter in CMV-based vectors.DepositorTypeEmpty backboneUseAAV; EucaryoticExpressionMammalianPromoterhUbCAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-HA
Plasmid#61355Purposeencodes c-terminal HA-tagged S. pyogenes dCas9 driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal HA tag
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only
