We narrowed to 7,496 results for: addgene/1000
-
Plasmid#128627PurposeMammalian Expression Plasmid of anti-Kv4.3 K+ channel (Rat). Derived from hybridoma K75/41.DepositorInsertanti-Kv4.3 K+ Channel (Rat) recombinant mouse monoclonal antibody (Kcnd3 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv4.2 K+ channel [L28/4R]
Plasmid#149453PurposeMammalian Expression Plasmid of anti-Kv4.2 K+ channel (Rat). Derived from hybridoma L28/4.DepositorInsertanti-Kv4.2 K+ channel (Rattus norvegicus) recombinant mouse monoclonal antibody (Kcnd2 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
hsp70: mKate2 dynactin1-811
Plasmid#105970Purposeheat shock inducible transgenesis, first coiled coil domain plus some more amino acids, truncated before second coiled coil domain, it's first 811 amino acids of dynactin subunit p150 glued, has dominant negative effect on dynein functionDepositorInsertdynactin1-811 (DCTN1 Human)
TagsmKate2ExpressionBacterialMutationcontains only amino acids 1-811Available SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Drd1a->M71-IRES-tauGFP ACNF TV
Plasmid#105073PurposeTargeting vector: the coding sequence of M71 is replaced by the sequence encoding amino acids 1-447 of Drd1a and an IRES-tauGFP followed by ACNF cassetteDepositorUseMouse TargetingMutationDrd1a coding sequence followed by IRES-tauGFP ACNFAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv2.1 K+ channel [L61C/30R]
Plasmid#177487PurposeMammalian Expression Plasmid of anti-Kv2.1 K+ channel (Rat). Derived from hybridoma L61C/30.DepositorInsertanti-Kv2.1 K+ channel (Rattus norvegicus) recombinant mouse monoclonal antibody (Kcnb1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_TH1477_2xUGI_3xHA
Plasmid#136659PurposeExpresses St1BE4max-TH1477 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianPromoterCAG and U6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-Versican [N351/23R]
Plasmid#128639PurposeMammalian Expression Plasmid of anti-Versican (Mouse). Derived from hybridoma N351/23.DepositorInsertanti-Versican (Mouse) recombinant mouse monoclonal antibody (Vcan Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv2.1 K+ channel pS603 [L61/14R]
Plasmid#140063PurposeMammalian Expression Plasmid of anti-Kv2.1 K+ channel pS603 (Mouse). Derived from hybridoma L61/14.DepositorInsertanti-Kv2.1 K+ channel pS603 (Rat) recombinant mouse monoclonal antibody (Kcnb1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceJune 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST26 Ago2 5A
Plasmid#60651PurposeExpresses 6xHis-Ago2 (N-termi tag) mutated five serines to alanines in mammalian cellsDepositorInsertArgonaute 2 (AGO2 Human)
Tags6xHis (N-termi tag)ExpressionMammalianMutationmutated five serines to alaninesPromoterCMVAvailable SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
Anti-NSD3 [N348/82R]
Plasmid#114485PurposeMammalian Expression Plasmid of anti-NSD3 (Human). Derived from hybridoma N348/82.DepositorInsertanti-NSD3 (Homo sapiens) recombinant mouse monoclonal antibody (NSD3 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIα-EGFP-CRY2-STIM1(318-450)
Plasmid#248300PurposeAn AAV construct designed to express a CRY2-fused truncated STIM1 fragment (a.a.318–450) under the control of the CaMKIIα promoter.DepositorInsertCRY2-fused truncated STIM1 fragment (a.a.318–450) (STIM1 Human)
UseAAVTagsEGFPExpressionMammalianMutationdeleted amino acids 1-317,451-685PromoterCamKllaAvailable SinceFeb. 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_AlphaSKE_ALFA_231232
Plasmid#250444PurposeExpresses tagged alpha skeletal muscle actin in mammalian cells. Protein is tagged with an internal ALFA tag at position T231/A232.DepositorInsertAlpha Skeletal Muscle Actin (ACTA1 Human)
TagsALFA Tag (Internal)ExpressionMammalianPromoterCMV PromotorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_BetaActin_ALFA_229230
Plasmid#250439PurposeExpresses tagged beta cytoplasmic actin in mammalian cells. Protein is tagged with an internal ALFA tag at position T229/A230.DepositorInsertBeta Cytoplasmic Actin (ACTB Human)
TagsALFA Tag (Internal)ExpressionMammalianPromoterCMV PromotorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIα-FLAG-STIM1(238-685)
Plasmid#248299PurposeAn AAV construct designed to express a CRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) under the control of the CaMKIIα promoter.DepositorInsertCRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) (STIM1 Human)
UseAAVTagsFLAGExpressionMammalianMutationdeleted amino acids 1-237PromoterCamKllaAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-EGFP-CRY2-STIM1(318-450)
Plasmid#248302PurposeAn AAV construct designed to express a CRY2-fused truncated STIM1 fragment (a.a.318–450) under the control of the GfaABC1D promoter.DepositorInsertCRY2-fused truncated STIM1 fragment (a.a.318–450) (STIM1 Human)
UseAAVTagsEGFPExpressionMammalianMutationdeleted amino acids 1-317,451-685PromoterGfaABC1DAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-FLAG-STIM1(238-685)
Plasmid#248301PurposeAn AAV construct designed to express a CRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) under the control of the GfaABC1D promoter.DepositorInsertCRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) (STIM1 Human)
UseAAVTagsFLAGExpressionMammalianMutationdeleted amino acids 1-237PromoterGfaABC1DAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA092 CCT3_IVS13-Cas9-BFP
Plasmid#249142PurposeOverexpression of SpCas9-BFP with CCT3 IVS13 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCCT3_IVS13-Cas9-TagBFP (CCT3 Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationCCT3 IVS13 intronPromoterEF1aAvailable SinceJan. 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA094 UBA1_IVS20-Cas9-BFP
Plasmid#249144PurposeOverexpression of SpCas9-BFP with UBA1 IVS20 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertUBA1_IVS20-Cas9-TagBFP (UBA1 Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationUBA1 IVS20 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only