We narrowed to 9,867 results for: Pol
-
Plasmid#24728DepositorInsertFull genome of Human polyomavirus 7
UseViral cloneAvailable SinceJune 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHPyV6-607a
Plasmid#24727DepositorInsertFull genome of Human polyomavirus 6
UseViral cloneAvailable SinceJune 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD27-52
Plasmid#98678PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase IIDepositorAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD43-52
Plasmid#98684PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase IIDepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
Tags6xHisExpressionBacterialMutationhepatds 43-52, residues 1888-1970Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD38-52
Plasmid#98685PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase IIDepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
Tags6xHisExpressionBacterialMutationheptads 38-52, residues 1853-1970Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD27-37
Plasmid#98686PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase IIDepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
Tags6xHisExpressionBacterialMutationheptads 27-37, residues 1773-1852Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD27-52_S1966C
Plasmid#98681PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase II with S1966CDepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
Tags6xHisExpressionBacterialMutationS1966CAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Stra6L-6His
Plasmid#174215PurposeStra6L-6His (N-Terminal) fusion protein driven by an CMV promotor. May be used to study the murine Vitamin A receptor Stra6L.DepositorAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD27-52_K5S
Plasmid#98679PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase II with K5SDepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
Tags6xHisExpressionBacterialMutationK1838S, K1859S, K1866S, K1873S, K1887SAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD27-52_N2A
Plasmid#98677PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase II with N2ADepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
Tags6xHisExpressionBacterialMutationN1775A, N1782AAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD27-52_del1961-1970
Plasmid#98680PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase II with del1961-1970DepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
Tags6xHisExpressionBacterialMutationdel1961-1970Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD27-52_N2A_S1966C
Plasmid#98682PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase II with N2A and S1966CDepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
Tags6xHisExpressionBacterialMutationN1775A, N1782A, S1966CAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD27-52_K5S_S1966C
Plasmid#98683PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase II with K5S and S1966CDepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
Tags6xHisExpressionBacterialMutationK1838S, K1859S, K1866S, K1873S, K1887S, S1966CAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYFP-RPB1aAmr
Plasmid#75284PurposeExpresses alpha-amanitin resistant EYFP tagged POLR2A in mammalian cellsDepositorInsertPOLR2A (POLR2A Human)
TagsEYFPExpressionMammalianMutationN792D alpha-amanitin–resistantPromoterCMVAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCV-R17a
Plasmid#24729DepositorInsertFull genome of Human Merkel Cell polyomavirus
UseCloning vectorAvailable SinceMay 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
p6VP1
Plasmid#24725DepositorInsertVP1 from Human Polyomavirus 6
ExpressionMammalianAvailable SinceJune 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
p7VP1
Plasmid#24726DepositorInsertVP1 from Human Polyomavirus 7
ExpressionMammalianAvailable SinceJune 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
pETM41-EcPPXc
Plasmid#38329DepositorInsertE. coli polyphosphatase (ppx Escherichia coli)
TagsHis, MBP, and TEVExpressionBacterialMutationC-terminus of E. coli polyphosphatase (described …PromoterT7Available SinceAug. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKM263-EcPPXc
Plasmid#38328DepositorInsertE. coli polyphosphatase (ppx Escherichia coli)
Tags6xHIS, GST, and TEVExpressionBacterialMutationC-terminus of E. coli polyphosphatase (described …PromoterT7Available SinceAug. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pYIAL31
Plasmid#60807Purposeused to make mutations in yeast POL1DepositorAvailable SinceFeb. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET 28 full-length human PARP1
Plasmid#192635PurposeExpresses human PARP1 with an N-terminal His-tagDepositorAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGGG-AH-VRT-A2
Plasmid#163703PurposeWheat transformation vector pGoldenGreenGate (pGGG) with OsActinP:: hygromycin (hpt) selection and the full native Triticum polonicum VRT-A2 gene (native prom::genomic seq::3'UTR)DepositorInsertsOs Actin promoter :: Hygromycin resistance gene (hpt) containing CAT1 intron :: NosTerminator
Triticum polonicum VRT-A2 genomic sequence (Native promoter:: genomic sequence::3'UTR) + Nos Terminator
ExpressionPlantPromoterRice - Os Actin promoter and Triticum polonicum V…Available SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
ph2p
Plasmid#22520DepositorInsertMPyV VP2
ExpressionMammalianAvailable SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
ph3p
Plasmid#22521DepositorInsertMPyV VP3
ExpressionMammalianAvailable SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
K-p11
Plasmid#38781DepositorInsert3742-450 of MWPyV
ExpressionBacterialPromoterlacAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
K-p35
Plasmid#38788DepositorInsert4385-462 of MWPyV
ExpressionBacterialPromoterlacAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
K-p27
Plasmid#38784DepositorInsert2533-3829 of MWPyV
ExpressionBacterialPromoterlacAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
K-p25
Plasmid#38782DepositorInsert203-1408 of MWPyV
ExpressionBacterialPromoterlacAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET-28a_6H-MMLV_RT_D524N-6H
Plasmid#166945PurposeBacterial expression of M-MLV reverse transcriptaseDepositorInsertgag-pol
Tags6X HisExpressionBacterialMutationD524N, H8YPromoterT7Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPapi
Plasmid#96921Purposeexpression of S aureus SaCas9 (SauCas9) and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in SpCas9-expressing cell lines for dual Cas9 "Big Papi" screens. aka pXPR207.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV CA Q67H/N74D
Plasmid#217442PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and Q67H/N74D mutations in capsid (CA Q67H/N74D).DepositorInsertgag/pol
UseLentiviralMutationCA Q67H,N74DAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRExpressionMammalianPromoterchick U6.3Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv5
Plasmid#237452PurposeLentiviral backbone for expressing doxycycline (Dox)-inducible, Pol II-driven hybrid guide (hg)RNAs.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9
Plasmid#246054PurposeExpression of a sgRNA targeting the GRIN2B locus and SauCas9 under the same pol-III H1 promoterDepositorInsertSauCas9 and sgRNA(GRIN2B)
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS22H-IRE
Plasmid#133905PurposePositive control when used in combination with pAWH-IRP. Expression of MS2BS-IRE site hybrid. Homology regions for recombination with pAWHDepositorAvailabilityAcademic Institutions and Nonprofits only -
pwP
Plasmid#22519DepositorInsertMPyV VP1
ExpressionMammalianMutationcodon modifiedAvailable SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
K-p26
Plasmid#38783DepositorInsert1334-2611 of MWPyV
ExpressionBacterialMutationOne SNP in comparison to MA095PromoterlacAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
K-p37
Plasmid#38789DepositorInsert3754-4585 of MWPyV
ExpressionBacterialMutation1SNP in comparison to WD976PromoterlacAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
K-p22
Plasmid#38787DepositorInsert2545-3841 of MWPyV
ExpressionBacterialMutation5 SNPs in comparison to WD976PromoterlacAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only