We narrowed to 29,185 results for: Tat
-
Plasmid#239339PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with two copies of mStayGold in mammalian cells. Assembles into nanocages tagged with 120 FPs.DepositorInsertI3-01
TagsmStayGoldExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDOC-K-glmS-GFPrev
Plasmid#158060PurposeDonor plasmid for insertion of eGFP and the constitutive acpP promoter into the S. Typhimurium chromosome. GFP is in the reverse orientation relative to the kanamycin resistance selectable markerDepositorInsertGreen Fluorescent Protein optimised for excitation with UV light
UseSynthetic BiologyExpressionBacterialPromoteracpPAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
HDM-Hgpm2
Plasmid#204152PurposeLentivirus helper plasmid coding for Gag/PolDepositorInsertHIV-1 gag/pol
ExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSerOTS-C1* (V70)
Plasmid#188537PurposePhosphoserine incorporation into recombinant proteinsDepositorInsertspSerRS
Ef-pSer
tRNApSer
ExpressionBacterialMutationmutations resulting from laboratory evolutionPromoterglnS*Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
HDM_VSV_G
Plasmid#204156PurposeVSV-G expression plasmidDepositorInsertVSV-G
ExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2_EF1a_TetOn_IRES_mCherry
Plasmid#204155PurposeLentivirus backbone expressing rtTA linked to mCherryDepositorInsertTet-On 3G
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB-EF1a-NLuc-IRES-Puro
Plasmid#130936PurposePiggyBac vector for constitutive NanoLuc expression in mammalian cellsDepositorInsertNanoLuc
ExpressionMammalianPromoterEF1aAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJAM1.18_PB-SDC4-PGK-Blast
Plasmid#205563PurposeExpress human SDC4DepositorAvailable SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
TEV Protease-mCherry
Plasmid#243793PurposeEncodes for mammalian expression of TEV protease input. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorInsertTEV protease
ExpressionMammalianAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-MAT2A
Plasmid#164820PurposeExpresses MAT2A in E. coli BL21(DE3)DepositorAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
HBV 1.3-mer X-null replicon
Plasmid#65461Purposecontaining 1.3 units of the X-null HBV genome (subtype ayw)DepositorInsert1.3 units of the X-null HBV genome
ExpressionMammalianAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-Trx-mSA2
Plasmid#52320PurposeSolubly expresses monomeric streptavidin containing S25H mutation in E. coli as a thioredoxin fusion. App Microbiol & Biotech 98, 6285-6295 (2014)DepositorInsertmonomeric streptavidin 2
TagsFLAG, His, S tag, TEV site, and ThioredoxinExpressionBacterialMutationS25H mutation compared to streptavidinPromoterT7Available SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLminP_Luc2P_RE59
Plasmid#90404PurposeSTAT3 - Sis-inducible element (SIE) gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterSTAT3Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-sRGN3.1-BlastR
Plasmid#220964PurposeExpresses human codon-optimized sRGN3.1DepositorInsertsRGN3.1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLminP_Luc2P_RE57
Plasmid#90402PurposeType I Interferon - ISGF3G (STAT1, STAT2, IRF9) gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterISREAvailable SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAIDA1
Plasmid#79180PurposeA construct with the AIDA surface expression system for display of a passenger protein flanked by His and Myc tagsDepositorInsertAdhesin Involved in Diffuse Adherence
TagsHis and MycExpressionBacterialPromoterlacUV5Available SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIJ8
Plasmid#68122PurposeTemperature sensitive plasmid for either lambda Red recombinase genes or flippase recombinase expressionDepositorInsertsflp recombinase
rhaS
rhaR
ExpressionBacterialPromoterrhamnoseAvailable SinceDec. 8, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAR-Ec633
Plasmid#130873PurposeA nuclear plasmid encoding an error-prone mutant TP-DNAP1 (L477V, L640Y, I777K, W814N) for OrthoRepDepositorInsertTP-DNAP1
ExpressionYeastMutationL477V, L640Y, I777K, W814NAvailable SinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-SlugCas9-BlastR
Plasmid#220965PurposeExpresses human codon-optimized SlugCas9DepositorInsertSlugCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only