We narrowed to 9,578 results for: CAG
-
Plasmid#185401PurposemCerulean-tDeg fluorogenic proteinDepositorInsertmCerulean-tDeg
ExpressionMammalianMutationWTPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEh_gRNA1
Plasmid#178758PurposeExpression of a gRNA that targets next to PAM library, used for E. haloalkaliphila type I-E systemDepositorInsertgRNA that targets next to PAM library, used for E. haloalkaliphila type I-E system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMs_gRNA1
Plasmid#178764PurposeExpression of a gRNA that targets next to PAM library, used for Marinomonas sp. type I-E systemDepositorInsertgRNA that targets next to PAM library, used for Marinomonas sp. type I-E system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLm_gRNA1
Plasmid#178752PurposeExpression of a gRNA that targets next to PAM library, used for L. mobilis type I-E systemDepositorInserta gRNA that targets next to PAM library, used for L. mobilis type I-E system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc2_gRNA1
Plasmid#178740PurposeExpression of a gRNA that targets next to PAM library, used for A. chroococcum type I-E #2 systemDepositorInsertgRNA that targets next to PAM library, used for A. chroococcum type I-E #2 system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
3919-32
Plasmid#176496PurposepCAG-puro-T2A-TetON3G-polyADepositorInsertpuroR-T2A-TetOn3G
ExpressionMammalianPromoterTREAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ssh2 gRNA#3
Plasmid#163399PurposeCas9-mediated knockout of Ssh2 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ssh3 gRNA#1
Plasmid#163400PurposeCas9-mediated knockout of Ssh3 in mammalian cellsDepositorAvailable SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
WIPI2d-TEVcs-TSF
Plasmid#171419PurposeFor the purifcation of WIPI2d proteinDepositorInsertWIPI2d (WIPI2 Human)
ExpressionMammalianAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PHY55-mouse U6-sgLMNA
Plasmid#164045PurposeU6-driven sgRNA targeting LMNADepositorInsertLMNA targeting sgRNA
UseCRISPRPromotermouse U6Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBSV2_Psyn-sgRNAmreB
Plasmid#149634PurposemreB gRNA expression in B. burgdorferiDepositorInsertsgRNAmreB
UseCRISPRExpressionBacterialPromoterPsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_Psyn-sgRNAmreB
Plasmid#149566PurposemreB gRNA expression in B. burgdorferiDepositorInsertsgRNAmreB
UseCRISPRExpressionBacterialPromoterPsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050V (wingless)
Plasmid#132424Purposeexpress arrays of gRNA targeting Wingless under dU6-3 promoterDepositorInsertwingless gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_ZNF503_2
Plasmid#135755PurposeEncodes gRNA for 3' target of human ZNF503DepositorAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_ZNF503_1
Plasmid#135754PurposeEncodes gRNA for 3' target of human ZNF503DepositorAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY105
Plasmid#130939PurposeEngineered sgRNA-LEA3 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEA3
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-RtcAshRNA1
Plasmid#126613PurposeExpresses shRNA against human RtcA under mouse U6 promoterDepositorInsertRtcA shRNA-1
UseRNAiPromotermouse U6 promoterAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-RtcAshRNA2
Plasmid#126614PurposeExpresses shRNA against human RtcA under mouse U6 promoterDepositorInsertRtcA shRNA-2
UseRNAiPromoterMouse U6 promoterAvailable SinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSM004
Plasmid#122937PurposeExpression of the marked mRNA under the control of substitutional promoters.DepositorInsertYML065W (Marked)
ExpressionYeastMutationYML065W: bp 52-63 GAGCAGGGAAAT to GAACAAGGTAACPromoter[tetO2]4inPgal1Available SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHOXC13.1.0-gDNA
Plasmid#113795PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor HOXC13DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only