180,072 results
-
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pACAGW-ChR2-Venus-AAV (AAV1)
Viral prep#20071-AAV1PurposeReady-to-use AAV1 particles produced from pACAGW-ChR2-Venus-AAV (#20071). In addition to the viral particles, you will also receive purified pACAGW-ChR2-Venus-AAV plasmid DNA. CAG-driven, channelrhodopsin fused to Venus for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPublicationPromoterCAGGTagsVenusAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO ChETA-EYFP (AAV5)
Viral prep#26968-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Ef1a-DIO ChETA-EYFP (#26968). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO ChETA-EYFP plasmid DNA. EF1a-driven, Cre-dependent, ChETA fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available sinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW63.YY1.FKBP.knock-in.BFP
Plasmid#104371PurposeFor knocking in FKBP F36V P2A BFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFKBP12(F36V) -P2A-BFP
Available sinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
DNA-PKcs T3950D
Plasmid#83320PurposeDNA-PKcs T3950ADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman DNA-PKcs (PRKDC Human)
ExpressionMammalianMutationActivation loop phosphorylation site 3950 substit…Available sinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSFV-Helper1
Plasmid#92073PurposeThis is a plasmid for transcription of defective helper RNA, providing structural Semliki forest virus (SFV) proteins to package recombinant SFV genomes into virus like particles.DepositorInsertcDNA of SFV genome with deletion removing the nonstructural SFV proteins and also the viral RNA packaging signal.
UseHelper plasmid, for run-off transcription and rna…Available sinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET-CjCas9
Plasmid#89754PurposeExpression of CjCas9 with His tag in E.coliDepositorInsertCjCas9
UseCRISPRTags6XHis, HA, and SV40 NLSExpressionBacterialPromoterT7Available sinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-3xFLAG-V5-ccdB
Plasmid#87064PurposeMammalian Gateway-compatible expression vector backbone with an N-terminal 3xFLAG-V5 tagDepositorTypeEmpty backboneTags3xFLAG-V5ExpressionMammalianAvailable sinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLQ2817 pPB: CAG-PYL1-VPR-IRES-Puro-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9
Plasmid#84239PurposeExpresses ABA-inducible VPR-Sp dCas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsABI-tagBFP-Sp dCas9
PYL1-VPR
UseCRISPR and Synthetic Biology; PiggybacTags2xNLS (SV40), ABI, HA tag, IRES-Puro, PYL1, and t…ExpressionMammalianPromoterCAG and PGKAvailable sinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV_Zika_NS5_Flag
Plasmid#79639PurposeThird generation Self-inactivating lentivector expressing NS5 from Zika virusDepositorInsertNS5
UseLentiviralTagsFlagExpressionMammalianPromoterEF1Available sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3-ALK5 wt
Plasmid#80876Purposemammalian expression of ALK5 WTDepositorAvailable sinceAug. 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pC003 - LshC2C2 locus into pACYC184 for spacer cloning
Plasmid#79152PurposeLshC2c2 locus in pACYC184 with BsaI sites for spacer cloningDepositorInsertLshC2c2 locus
Mutation*Available sinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3-HA-RIPK1
Plasmid#78834PurposeTo overexpress RIPK1 in Mammalian CellDepositorAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
R777-E283 Hs.ROCK1
Plasmid#70567PurposeGateway ORF clone of human ROCK1 [NM_005406.2] with stop codon (for native or N-terminal fusions)DepositorInsertROCK1 (ROCK1 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-mOXT-hM3Dq-mCherry-WPRE
Plasmid#70717PurposeExpresses DREADDs Gq receptor under oxytocin promoter controlDepositorInserthM3Dq-mCherry
UseAAVTagsmCherryPromotermouse oxytocinAvailable sinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDH-EF1-copGFP-T2A-Puro
Plasmid#72263PurposeExpress copGFP and puromycin resistance gene under EF1 promoterDepositorInsertcopGFP-T2A-Puro
UseLentiviralExpressionMammalianPromoterelongation factor-1Available sinceJan. 11, 2016AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
MSP2135
Plasmid#72248PurposeHuman expression plasmid for SpCas9-HF2 variant: CMV-T7-humanSpCas9-HF2(N497A, R661A, Q695A, Q926A, D1135E)-NLS-3xFLAGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmammalian codon-optimized Streptococcus pyogenes Cas9 HF2(N497A/R661A/Q695A/Q926A/D1135E)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, and D1135EPromoterCMVAvailable sinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDEST-FRT/T0-Flag-BRCA1
Plasmid#71117Purposemammalian expression of Flag-BRCA1 siRNA resistant constructDepositorAvailable sinceNov. 12, 2015AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pmtb-t7-alpha-bungarotoxin
Plasmid#69542PurposeFor in vitro transcription of alpha-bungarotoxin mRNA that can be injected into embryos.DepositorInsertalpha-bungarotoxin
UseTol2, beta-actin promoter, sp6,t7 for zebrafishPromoterbeta-actin, sp6, t7Available sinceNov. 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMito-rxRFP1.1
Plasmid#67841Purposeredox-sensitive red fluorescent protein rxRFP1.1, mitochondrially localizedDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertrxRFP1.1 and mitochondrial localization sequence
TagsHis Tag and mitochondrial localization sequenceExpressionMammalianPromoterCMVAvailable sinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by