We narrowed to 4,733 results for: Gca
-
Viral Prep#167572-AAV1PurposeReady-to-use AAV1 particles produced from AAV-hSyn-Ribo-jGCaMP8s (#167572). In addition to the viral particles, you will also receive purified AAV-hSyn-Ribo-jGCaMP8s plasmid DNA. Synapsin-driven neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8s. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pET21b(+)_SARS-CoV-2_3CLpro-Q306A
Plasmid#177334Purposebacterial expression of active SARS-CoV-2 3C-like proteinaseDepositorInsertSARS-CoV-2 3C-like proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsFactor Xa site-3xFlag-Myc-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceNov. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV_BiPVe3_GCaMP6f (AAV PHP.eB)
Viral Prep#213943-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiPVe3_GCaMP6f (#213943). In addition to the viral particles, you will also receive purified pAAV_BiPVe3_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the PV+ basket cell-targeting enhancer E3. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8f-WPRE (AAV5)
Viral Prep#162376-AAV5PurposeReady-to-use AAV5 particles produced from pGP-AAV-syn-jGCaMP8f-WPRE (#162376). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8f-WPRE plasmid DNA. Syn-driven expression of ultrafast calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-H2B-jGCaMP8s-WPRE (AAV9)
Viral Prep#176749-AAV9PurposeReady-to-use AAV9 particles produced from AAV-Syn-H2B-jGCaMP8s-WPRE (#176749). In addition to the viral particles, you will also receive purified AAV-Syn-H2B-jGCaMP8s-WPRE plasmid DNA. Syn-driven expression of histone H2B fused to calcium sensor GCaMP8s. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe4_GCaMP6f (AAV1)
Viral Prep#213939-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiPVe4_GCaMP6f (#213939). In addition to the viral particles, you will also receive purified pAAV_BiPVe4_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the chandelier cell-targeting enhancer E4. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Soma-jGCaMP8f (AAV Retrograde)
Viral Prep#169258-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-hSyn-Soma-jGCaMP8f (#169258). In addition to the viral particles, you will also receive purified AAV-hSyn-Soma-jGCaMP8f plasmid DNA. Synapsin-driven neuronal expression of soma-targeted calcium sensor jGCaMP8f. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1a-jGCaMP8m-WPRE (AAV Retrograde)
Viral Prep#176757-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-EF1a-jGCaMP8m-WPRE (#176757). In addition to the viral particles, you will also receive purified AAV-EF1a-jGCaMP8m-WPRE plasmid DNA. EF1a-driven expression of calcium sensor GCaMP8m. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-mDlx-jGCaMP8m-WPRE (AAV Retrograde)
Viral Prep#176754-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-mDlx-jGCaMP8m-WPRE (#176754). In addition to the viral particles, you will also receive purified AAV-mDlx-jGCaMP8m-WPRE plasmid DNA. mDlx enhancer-driven expression of calcium sensor GCaMP8m in GABA-ergic interneurons. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Wolfe-Lawson ZFN modular assembly kit
Plasmid Kit#1000000018PurposeEngineering zinc finger arrays by modular assembly.DepositorApplicationGenome EditingVector TypeZebrafish ExpressionEditing TypeZFNAvailable SinceNov. 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUDP082
Plasmid#103875PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces marxianusDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces marxianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCPP5912
Plasmid#128703PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) and chaperone Gateway donor cloneDepositorInsertshcE-avrE1
ExpressionBacterialMutationThree synonymous mutations Ala 362 (GCT-GCC), Ala…Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-H2B-jGCaMP8m-WPRE (AAV Retrograde)
Viral Prep#176748-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-Syn-H2B-jGCaMP8m-WPRE (#176748). In addition to the viral particles, you will also receive purified AAV-Syn-H2B-jGCaMP8m-WPRE plasmid DNA. Syn-driven expression of histone H2B fused to calcium sensor GCaMP8m. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLIK_Hyg_mTurquoise2_Atg4BC74A
Plasmid#161733PurposeDoxycycline-inducible expression of Atg4B(C74A) fused with mTurquoise2 to inhibit autophagyDepositorInsertAtg4B(C74A) (Atg4b Mouse) (Atg4b Mouse)
UseLentiviral; Destinatioin vector for gateway cloni…TagsmTurquoise2ExpressionMammalianMutation220-222 TGC (Cys) is changed to GCA (Ala)Available SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
AiP14871: pAAV-AiE0779m_3xC2-minBG-RiboL1-jGCaMP8s-WPRE3-BGHpA (Alias: CN4871) (AAV1)
Viral Prep#214865-AAV1PurposeReady-to-use AAV1 particles produced from AiP14871: pAAV-AiE0779m_3xC2-minBG-RiboL1-jGCaMP8s-WPRE3-BGHpA (Alias: CN4871) (#214865). In addition to the viral particles, you will also receive purified AiP14871: pAAV-AiE0779m_3xC2-minBG-RiboL1-jGCaMP8s-WPRE3-BGHpA (Alias: CN4871) plasmid DNA. Neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8s under the minBG promoter. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
PRS_8-GCaMP8m (AAV2)
Viral Prep#210400-AAV2PurposeReady-to-use AAV2 particles produced from PRS_8-GCaMP8m (#210400). In addition to the viral particles, you will also receive purified PRS_8-GCaMP8m plasmid DNA. PRS-driven expression of calcium sensor GCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterPRSx8Available SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe4_GCaMP6f (AAV PHP.eB)
Viral Prep#213939-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiPVe4_GCaMP6f (#213939). In addition to the viral particles, you will also receive purified pAAV_BiPVe4_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the chandelier cell-targeting enhancer E4. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUDP025
Plasmid#103874PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces lactisDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces lactis
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-CmYLCV
Plasmid#205245PurposeFor plant prime editing in wheat plants or monocotyledons protoplastsDepositorInsertCmYLCV-csy4_binding_site-esgRNA-tevopreQ1-csy4_binding_site
UseCRISPRExpressionPlantPromoterCmYLCVAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Antibody#184180-rAbPurposeAnti-6xHis recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistry and Western BlotReactivitySyntheticSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceSept. 2, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
TNPO1-shRNA
Plasmid#86082PurposeA lentiviral construct for building stable cell lines expressing Transportin-1 shRNA via puromycin selection.DepositorAvailable SinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-jGCaMP8s-WPRE (AAV Retrograde)
Viral Prep#179256-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-CAG-jGCaMP8s-WPRE (#179256). In addition to the viral particles, you will also receive purified AAV-CAG-jGCaMP8s-WPRE plasmid DNA. CAG-driven expression of calcium sensor GCaMP8s. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1a-jGCaMP8f-WPRE (AAV Retrograde)
Viral Prep#176756-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-EF1a-jGCaMP8f-WPRE (#176756). In addition to the viral particles, you will also receive purified AAV-EF1a-jGCaMP8f-WPRE plasmid DNA. EF1a-driven expression of calcium sensor GCaMP8f. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-mDlx-jGCaMP8s-WPRE (AAV Retrograde)
Viral Prep#176755-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-mDlx-jGCaMP8s-WPRE (#176755). In addition to the viral particles, you will also receive purified AAV-mDlx-jGCaMP8s-WPRE plasmid DNA. mDlx-driven expression of the calcium sensor jGCaMP8s in GABA-ergic interneurons. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1a-jGCaMP8s-WPRE (AAV Retrograde)
Viral Prep#176758-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-EF1a-jGCaMP8s-WPRE (#176758). In addition to the viral particles, you will also receive purified AAV-EF1a-jGCaMP8s-WPRE plasmid DNA. EF1a-driven expression of calcium sensor GCaMP8s (more sensitive). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-GCaMP6s-P2A-mKate2 (AAV9)
Viral Prep#112006-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSynapsin1-GCaMP6s-P2A-mKate2 (#112006). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-GCaMP6s-P2A-mKate2 plasmid DNA. hSyn-driven expression of calcium sensor GCaMP6s and bicistronic mKate2. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmKate2Available SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL3-pegRNA-attL2
Plasmid#213052PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL3 and attL2DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-B
Plasmid#177787PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL1-pegRNA-attR3
Plasmid#213051PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attR3DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only