We narrowed to 82,772 results for: TRI
-
Plasmid#192183PurposeClone 16 (HH02) pFUSE-IgG1-Hole mutation-hole-clone2DepositorInsertClone 2 heavy chain (HH02)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-COSMC-KO
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorInsertCOSMC (C1GALT1C1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shID2 #1
Plasmid#83086PurposeLentiviral shRNA vector for inducible knockdown of human ID2DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-ChRmine-mScarlet
Plasmid#137158PurposeViral expression of ChRmine-p2a-mScarletDepositorHas ServiceAAV8InsertChRmine-p2a-mScarlet
UseAAVMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
H2B-GFP-Aurora B WT
Plasmid#184042PurposeExpresses H2B-GFP fused to Aurora B WTDepositorAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX(frt)-GCaMP6f-WPRE
Plasmid#118273PurposepAAV vector for flippase dependent GCaMP6f expression under the control of EF1a promoterDepositorInsertGCaMP6f
UseAAVTags6xHis (N terminal on insert), T7 epitope, and Xpr…ExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-ColX
Plasmid#222305PurposeSynchronize the trafficking of CollagenX from the ER.DepositorInsertStreptavidin-KDEL and CollagenX fused to SBP-EGFP (COL10A1 Human)
ExpressionMammalianMutationsignal peptide of COL10A1 removedPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-gp135
Plasmid#222306PurposeSynchronize the trafficking of gp135/podocalyxin from the ER.DepositorInsertStreptavidin-KDEL and gp135 fused to SBP-EGFP (PODXL Rabbit)
ExpressionMammalianMutationsignal peptide removedPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-3'UTR-TNF
Plasmid#153069PurposeHuman TNF 3'UTR region cloned downstream of luciferase reporter geneDepositorAvailable SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H74
Plasmid#170338PurposemTDel_EPACdDEPCD_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTDel_EPACdDEPCD_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-mCherry-p53 deltaN
Plasmid#49243Purposeexpresses human p53 deltaN and mCherry in mammalian cellsDepositorInsertp53 deltaN (TP53 Human)
TagsIRES-mCherryExpressionMammalianMutationdeltaN ( lacks 39 residues at the N-terminus)PromoterCMVAvailable SinceDec. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
R619-M87-303: CMV51p> SARS-CoV S-2P-T4f-3C-His8-Strep2x2
Plasmid#166012Purposemammalian expression of SARS-CoV soluble spike trimer proteinDepositorInsertSARS-CoV S (spike)
Tags3C-His8-Strep2x2ExpressionMammalianPromoterCMV51Available SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
139H2_HC
Plasmid#206201PurposeFor recombinant expression of the full heavy chain of the Mouse anti-MUC1 antibody 139H2 in mammalian cells. Includes a C-terminal -His8 tag for purification.DepositorInsertanti-MUC1 antibody 139H2 heavy chain (Ighg1 Mouse)
Tags-AAAHHHHHHHHExpressionMammalianPromoterCMVAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR
Plasmid#135500PurposeMammalian expression of FLAG-tagged TAPBPRDepositorInsertTAPBPR (TAPBPL Human)
TagsLuminal FLAG epitope tag and Signal peptide from …ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-mRuby3-WPRE
Plasmid#107744PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.DepositorInsertmRuby3
UseAAVExpressionMammalianPromoterCAGAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hOCT3/4-shp53-F + mCherry-2A-puro
Plasmid#74947PurposeDosage control and tracing of reprogramming episomesDepositorInsertOct3/4 (POU5F1 Human)
ExpressionMammalianAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
Integrin beta5-2XEGFP
Plasmid#139779PurposeDetecting Integrin beta5 by fluorescence microscopyDepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pALS2-sfGFP WT
Plasmid#197575PurposeFluorescence control plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-WT and M. alvus Pyl-tRNA(6). p15a origin of replicationDepositorInsertssfGFP WT
M. alvus Pyl-tRNA (6)
TagsHis6ExpressionBacterialPromoteraraC and lppAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT-Hrp48-ADARcd-V5
Plasmid#81172Purposeidentification of cell-specific targets of RNA binding proteinsDepositorInsertHrp48-ADARcd fusion (Hrb27C Fly)
ExpressionInsectPromoterDrosophila metallothionein promoterAvailable SinceAug. 12, 2016AvailabilityAcademic Institutions and Nonprofits only