We narrowed to 9,772 results for: Tec
-
Plasmid#246733PurposeMammalian expression of human DNAJC5 wildtype with a mCitrine (YFP) tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCitrineExpressionMammalianPromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222-SIN3B-3xFLAG
Plasmid#109214PurposeEncodes human full-length SIN3B with a C-terminal 3xFLAG tag to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPU-huMDA5-miR30-MDA5
Plasmid#174224PurposeAll-in-one huMDA5 rescue-MDA5 shRNA knockdown vectorDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOET5 CVB3-VLP
Plasmid#218146PurposeForms coxsackievirus 3-like particle in insect cells by expression of VP1–VP4 polyprotein (GeneID M33854.1) and 3CD protease (GeneID M33854.1).DepositorInsertsVP1–VP4
3CD
ExpressionInsectPromoterCMV and PolyhedrinAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP779_αGCN4-VP64-CO
Plasmid#211772PurposeSunTag counterpart binding domain, αGCN4, fused to transcriptional activator VP64, with GFP selectionDepositorInsertaGCN4-VP64
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect VP64 e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP786_SpyCatcher-EZH2-FL-CO
Plasmid#211779PurposeSpyTag counterpart binding domain, SpyCatcher, fused to polycomb repressive complex subunit EZH2, with GFP selectionDepositorInsertaGCN4-KRAB
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP787_SnoopCatcher-EZH2-FL-CO
Plasmid#211780PurposeSnoopTag counterpart binding domain, SnoopCatcher, fused to polycomb repressive complex subunit EZH2, with GFP selectionDepositorInsertaGCN4-DNMT3A
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP780_SpyCatcher-KRAB-CO
Plasmid#211773PurposeSpyTag counterpart binding domain, SpyCatcher, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertSpyCatcher-KRAB
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP784_SnoopCatcher-DNMT3A-CO
Plasmid#211777PurposeSnoopTag counterpart binding domain, SnoopCatcher, fused to DNA methyltransferase DNMT3A, with GFP selectionDepositorInsertSpy-EZH2
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect EZH2 e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP790_αGCN4-EZH2-FL-CO
Plasmid#211784PurposeSunTag counterpart binding domain, aGCN4, fused to polycomb repressive complex subunit EZH2, with GFP selectionDepositorInsertSnoopCatcher-KRAB
Tags2xOLLASExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBVboostFGII WPRE 2A-CVB3
Plasmid#202076PurposeBacterial expression of 2A protease from coxsackievirus B3 (CVB3). Contains C-terminal His6-tag.DepositorInsertCVB3 2A protease with HisTag
Tags6xHis-tagExpressionBacterial, Insect, and Mamm…Promoterpolh, CAG, T7Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RIPK3[V458A][Q459A][V460A][G461A]-FLAG
Plasmid#199328Purposemutated RHIM motive (interaction inhibited)DepositorInsertReceptor-interacting serine/threonine-protein kinase 3 (RIPK3 Human)
TagsFLAGExpressionMammalianMutationchanged V458, Q459,V460 and G461 to alanineAvailable SinceJune 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin S268A/270A
Plasmid#199608PurposeEncodes N-terminal eGFP-tagged P1-gephyrin S268/270A for expression in mammalian cells.DepositorAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Sa-gRNA-puro
Plasmid#191652PurposeLentiviral expression of puromycin resistance gene and S. aureus scrambled non-targeting gRNA ; useful for changing gRNA by mutagenesis.DepositorInsertS. aureus gRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1026-Tier1-PhCMV-3xNLS-iRFP670
Plasmid#169532PurposeTier-1 vector encoding PhCMV-driven iRFP670 that is localized to the nucleus (PhCMV-3xNLS-iRFP670-pA).DepositorInsertPCMV-driven nucleus-localized far-red fluorescent protein iRFP670
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CIBN-rTetR
Plasmid#183919PurposeOptogenetic CIBN localizer domain coupled to reverse Tet repressor; binds tetO sites upon doxycycline addition; CIBN is bound by PHR upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP
Plasmid#183926PurposeOptogenetic PHR domain coupled to GFP; binds to CIBN upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV superYFP-AURKA K162M-mTurq2
Plasmid#157773PurposeExpression of AuroraA kinase-dead biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
TagsmTurquoise2 and superYFPExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-TC
Plasmid#162492PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only