We narrowed to 2,903 results for: GFP reporter gene
-
Plasmid#217753PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 plus vector-based linker LE…PromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSico-CAG-v-H-Ras-IRES-Luciferase/EGFP
Plasmid#58959Purposelentiviral expression of v-H-Ras and luciferase/EGFP reporterDepositorInsertsCMV enhancer/chicken beta actin promoter
v-H-Ras
luc2/EGFP fusion gene
UseLentiviralExpressionMammalianPromoterCMV enhancer/chicken beta actinAvailable SinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
SOX9-T2A-H2B-EGFP repair template
Plasmid#167972PurposeSOX9 reporter repair templateDepositorInsertSRY-Box Transcription Factor 9 (SOX9 Human)
UseCRISPR; Donor templateTagsH2B-EGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EmGFP-LATS2/1 KD
Plasmid#52085PurposeLentiviral RNAi vector for knockdown of LATS2 and LATS1. Co-expresses EmGFP as reporterDepositorAvailable SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
LSM081 SFFV-mCherry-SGc(stem-1(3xMS2)2-stops)cSG-EGFP (FLP-IN)
Plasmid#233440PurposeSFFV driven LIDAR reporter with an additional stop codon on the stem loopDepositorInsertSGc(stem-1(3xMS2)2-stops)cSG-EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
XZ388 (IVT) CMV-TO-T7-EGFP-SGc(stem-1(3xMS2))cSG-Cre-hybridUTR3
Plasmid#233424PurposeIVT template for LIDAR reporter mRNA; EGFP as marker, Cre recombinase as outputDepositorInsertT7-EGFP-SGc(stem-1(3xMS2))cSG-Cre-hybridUTR3
ExpressionMammalianMutationWTPromoterCMVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-Lyn-EGFP
Plasmid#196875PurposeNeuron-specific expression of LynGFP reporterDepositorInsertLynEGFP
UseCre/LoxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-pA]-lox-Lyn-EGFP
Plasmid#196876PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertLynEGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MYC-GFP-IRES-mCherry
Plasmid#231232PurposeMYC stability reporter construct (expressing c-myc 2) for transient expression in mammalian cells. Stability of GFP-fusion protein can be assed by flow cytometry by normalizing to mCherry expression.DepositorInsertMYC (MYC Human)
ExpressionMammalianAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MCRS1-GFP-IRES-mCherry
Plasmid#231231PurposeMCRS1 stability reporter construct for transient expression in mammalian cells. Stability of GFP-fusion protein can be assed by flow cytometry by normalizing to mCherry expression.DepositorInsertMCRS1 (MCRS1 Human)
ExpressionMammalianAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-hDNAJC6-T2A-copGFP
Plasmid#170443PurposeLentiviral vector expressing human DNAJC6 with copGFP reporter gene, under control of EF1alpha promoterDepositorAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2X-KSR1-CA3-EGFP (2x-C-KSR)
Plasmid#217756PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationTwo tandem CA3 domain (aa 317-400) 1st linker GG…PromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
[#GS7-LV] DsRed GFP TEVp Zeo Switch - Recipient
Plasmid#233507PurposeLentiviral construct for the MitoTRACER genetic reporter to be expressed in the recipient cellsDepositorInsertDsRed loxP eGFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-GFP-3xmiR122-WPRE-HGHpA
Plasmid#183775PurposeAAV genome with a CAG driven eGFP reporter with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertNLS-GFP
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcs2-MTSmut-cox8A(XXXX)-GFP-IRES-mCherry
Plasmid#226104PurposeStability reporter construct of the COX8A mitochondrial targeting sequence (MTS) with mutations that impair recognition by SIFI for transient expression in mammalian cellsDepositorInsertCOX8A (COX8A Human)
TagsGFPExpressionMammalianMutationencodes only for mitochondrial targeting sequence…Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNES-PRKCZ-C20-EGFP (C-NES-PRKCZ-C20)
Plasmid#217763PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertProtein kinase C zeta (PRKCZ Human)
TagsEGFPExpressionMammalianMutationNES (ALQKKLEELELDEAPVAT) plus C20 domain (aa 405-…PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSPORT1[attB/Ins1/NbT promoter/glGFP/bglobin 3'-UTR/Ins2]
Plasmid#74102Purposeplasmid driven under neuronal beta-tubulin promoter, bearing attB and two insulator sequences (opposite directions pointing inward towards the reporter gene)DepositorInsertsXenopus laevis beta-tubulin gene promoter region and 5'UTR
Green Lantern Green Fluorescent Protein
Rabbit beta 1-globin gene 3'UTR
ExpressionBacterialAvailable SinceMay 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSbi-pur-EGFP-KSR1-CA3 (N-KSR)
Plasmid#217769PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseSleeping beauty transposase-compatible genome ins…TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400PromoterEF-1alpha promoterAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSbi-pur-KSR1-CA3-EGFP (C-KSR)
Plasmid#217768PurposeFluorescent reporter for ceramide (for stable mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseSleeping beauty transposase-compatible genome ins…TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 plus vector-based linker LE…PromoterEF-1alpha promoterAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pETM11-SUMO3- sfGFP-KSR1-CA3 (N-KSR)
Plasmid#217767PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseProtein purification (6xhis tag, tev site, sumo3 …TagssfGFPExpressionBacterialMutationCA3 domain aa 317-400PromoterT7 promoterAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pETM11-SUMO3-KSR1-CA3-sfGFP (C-KSR)
Plasmid#217766PurposeFluorescent reporter for ceramide (for bacterial expression and purification)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseProtein purification (6xhis tag, tev site, sumo3 …TagssfGFPExpressionBacterialMutationCA3 domain aa 317-400 plus vector-based linker LE…PromoterT7 promoterAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLe6Δ -hLP-mcs/(EGFP-IresPuro-hInt)
Plasmid#64314Purposechondrocyte-specific COL11A2 promoter/enhancer lentiviral reporter vector to select iChon cellsDepositorUseLentiviralTagsEGFP and IRES-PUROExpressionMammalianMutationN/AAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ E4F1 degron(220-242)-GFP-IRES-mCherry
Plasmid#231007PurposeProtein stability reporter construct for E4F1 consisting of aa 220-242 for transient overexpression in mammalian cells.DepositorAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA(mut 8356-8370)](pAVA3874)
Plasmid#239353PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(WT)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(WT)-mascRNA(mut 8356-8370: ctacgaccacc…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ GFP-CDK5R1 degron (283-307)-IRES-mCherry
Plasmid#231008PurposeProtein stability reporter construct for CDK5R1 consisting of aa 283-307 for transient overexpression in mammalian cells.DepositorAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1079 - pAAV TH gRNA A EF1a EGFP
Plasmid#113159PurposeAn AAV vector that expresses guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2AGFP-W
Plasmid#67981PurposeCas9 activity reporter (control) with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPREAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W
Plasmid#67979PurposeCas9 activity reporter (control) with BFP and GFP.DepositorInsertU6gRNA cassette, PGKBFP2AGFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX304-GW-DCK*-IRES-GFP
Plasmid#176291PurposeGateway vector for use in generating POI-DCK* fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX304-DCK*-GW-IRES-GFP
Plasmid#176289PurposeGateway vector for use in generating DCK*-POI fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gBFP)-PGKGFP2ABFP-W
Plasmid#67984PurposeCas9 activity reporter with GFP and BFPDepositorInsertsU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKGFP2ABFP-W
Plasmid#67983PurposeCas9 activity reporter (control) with GFP and BFPDepositorInsertU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MYC(Δ1-143)-GFP-IRES-mCherry (ΔTAD)
Plasmid#231233PurposeMYC stability reporter construct with deletion of the N-terminal region (residues 1-143) for transient expression in mammalian cellsDepositorInsertMYC (MYC Human)
ExpressionMammalianMutationTAD deleted (delta1-143); numbering based on sequ…Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNES-SET-EMD-EGFP (C-NES-SET-EMD)
Plasmid#217770PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertSET (SET Human)
TagsEGFPExpressionMammalianMutationEMD domain (aa 70-226) plus nuclear export sequen…PromoterCMVAvailable SinceJune 12, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
JDW 249 (pTol2-Dll4-F2-ETS#2-WT-8X-E1b-EGFP)
Plasmid#156417Purpose8X copies of the ETS#2 site of the murine Dll4 intronic enhancer and a minimal E1b reporter driving expression of EGFP flanked by Tol2 sitesDepositorInsertmurine Dll4 F2-6/F8 ETS site B/ site #2, 8X
UseZebrafish transgenesisPromoterE1b min pro/b-globin intronAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT2-shATRX-GFP
Plasmid#124259PurposeExpresses shRNA targeting ATRX with a GFP reporter which is driven by the SV40 promoter. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshATRX
ExpressionMammalianAvailable SinceJuly 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-rtTA-IRES-nls-EGFP-WPRE-bGH-pA (JDW 410)
Plasmid#229807PurposeA CAGGS driven tet-on transactivator with an nls-EGFP reporterDepositorInsertrtTA-IRES-nls-EGFP
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA(mut 8356-8370)](pAVA3871)
Plasmid#239352PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(C8351G)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370: ctacgac…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only