172,805 results
-
Plasmid#108851PurposeEncodes for human EphA2 fluorescently labeled with mTurquoise on the C-Terminus via a 15 amino acid (GGS)5 flexible linkerDepositorInsertEPHA2 (EPHA2 Human)
TagsLabeled with mTurquoise on the C-Terminus via a 1…ExpressionMammalianAvailable SinceApril 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAX APP Swe/Ind
Plasmid#30145DepositorInserthuman APP 695 Swedish/Indiana mutation (APP Human)
ExpressionMammalianMutationSwedish and Indiana; K595N, M596L and V642FAvailable SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
CCR2-DuET
Plasmid#213198PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEFBOS_CreIRESpuro
Plasmid#183812PurposeExpresses Cre recombinase and puromycin N-acetyltransferase driven by the mammalian EF1a promoterDepositorInsertCre recombinase
UseSynthetic BiologyTagsNLSExpressionMammalianAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-TOMM20
Plasmid#227307PurposeDonor template for mStayGold insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mStayGold Tag (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-deltaOVA
Plasmid#64595PurposeExpression of N-terminally truncated chicken ovalbumin as model antigen for study of MHC class I and class II presentationDepositorInsertOvalbumin
ExpressionMammalianMutationLacking first 49 aa (leader sequence for transloc…PromoterCMVAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPB_mU6_enh-gRNA_Puro-T2A-BFP
Plasmid#235571PurposeEnhanced guide RNA expression & genomic integration. Target gRNA sequences are cloned in via the BstXI and BlpI sites.DepositorInsertsgRNA backbone
UseCRISPRAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
LiOn*-CAG∞RFP
Plasmid#154019PurposeVector based on the LiOn integration-coupled translational switch and devoid of TTAA sequences, expressing the fluorescent protein mRFP1 from a CAG promoter upon action of the piggyBac transposaseDepositorInsertmRFP1
ExpressionMammalianMutationAll TTAA in vector backbone were replaced by sile…PromoterCAGAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-hISG15
Plasmid#12447DepositorAvailable SinceJan. 4, 2007AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CMVs.Pl.Cre.rBG (AAV5)
Viral Prep#105537-AAV5PurposeReady-to-use AAV5 particles produced from pENN.AAV.CMVs.Pl.Cre.rBG (#105537). In addition to the viral particles, you will also receive purified pENN.AAV.CMVs.Pl.Cre.rBG plasmid DNA. CMV-driven Cre. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCMVAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
CD40L-SrtA
Plasmid#121167PurposepMP71 vector expressing Tomato - P2A - CD40L - SrtA - flagDepositorInsertCD40L-SrtA
UseRetroviralTagsTomato and flagExpressionMammalianAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-HA-AT1R-YFP
Plasmid#101659PurposeExpresses AT1R with HA tag and YFP in mammalian cells.DepositorInsertAngiotensin II type 1 receptor (AGTR1 Human)
TagsHA and YFP (Venus)ExpressionMammalianPromoterCAG promoterAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) K-Ras(G12C)
Plasmid#224284PurposeCell transfection and expression of K-Ras (G12C)DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDARMO_HUWE1_3xFLAG
Plasmid#187155Purposemammalian cell expression of HUWE1-3xFLAGDepositorAvailable SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
nLuc_AP4_TEVs_P3mS
Plasmid#119299PurposeExpresses N-terminus of split luciferase fused to antiparallel coiled-coil AP4 connected with autoinhibitory coil P3mS and TEV cleavage site in antiparallel harpin linker/for SPOC logicDepositorInsertsplit nLuc fused to antiparallel Coiled-coil AP4 connected with P3 via TEV cleavable linker
UseLuciferaseTagsMyc tagExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-Guide
Plasmid#85401PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes in combination with inducible Cas9 expresssion by pLenti-iCas9-neoDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRPML1-mCherry
Plasmid#135189PurposeExpresses TRPML1 with C-terminus mCherry tag in mammalian cells.DepositorAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
FH1-MGT#2-mCherry
Plasmid#164097PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertMGT#2-mCherry
UseLentiviral and Synthetic BiologyAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
ECFP HO
Plasmid#207413PurposeMammalian-cell-based plasmid system that expresses ECFP (a non R-loop-forming transcript) upon dox-induction, which will further cause head-ON transcription-replication conflict (HO TRC).DepositorInsertECFP
ExpressionBacterial and MammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only