We narrowed to 41,880 results for: LAT;
-
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLM3713
Plasmid#49946PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMG058 MBP-GS 634-666-His
Plasmid#154077PurposeExpresses MBP-GS 634-666-His (human 33aa Glycogen Synthase peptide as a fusion protein with MBP and His- tags) in E.coliDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
hHSF1 S303A
Plasmid#118363PurposeThis plasmid expresses human HSF1 S303A mutant, which cannot undergo sumoylation on K298 due to disrupted PDSM motif.DepositorAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-DN-RFX
Plasmid#52296PurposeDominant-negatively inhibits RFX (regulatory factor X) transcription factor. Made of mouse RFX1 DNA binding domain (400-527 aa) and C-terminal myc tag.DepositorInsertDominant negative RFX
TagsMycExpressionMammalianPromoterCAG promoterAvailable SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.2 (20-362)
Plasmid#177845PurposeBacterial Expression of SnRK2.2DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-3xNLS-OptoJNKi
Plasmid#89740PurposeExpression of light-regulated JNK inhibitor, mCherry-tagged, localised to nucleus, wild-type photosensor, inhibitor JIP11DepositorInsertNLS-OptoJNKi
UseFluorescent proteinTagsmCherryExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLM3727
Plasmid#49961PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKCAG-mCherry-OptoJNKi
Plasmid#89738PurposeExpression of light-regulated JNK inhibitor, wild-type photosensor, inhibitor JIP11DepositorInsertOptoJNKi
UseFluorescent proteinTagsmCherryExpressionMammalianPromoterCAGAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-NES-OptoJNKi
Plasmid#89739PurposeExpression of light-regulated JNK inhibitor, mCherry-tagged, localised to cytoplasm, wild-type photosensor, inhibitor JIP11DepositorInsertNLS-OptoJNKi
UseFluorescent proteinTagsmCherryExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKCAG-H2BmCherry-OptoJNKi
Plasmid#89741PurposeExpression of light-regulated JNK inhibitor, mCherry-tagged, localised to chromatin with H2B, wild-type photosensor, inhibitor JIP11DepositorInsertOptoJNKi
UseOptogeneticsTagsHistone2B and mCherryExpressionMammalianPromoterCAGAvailable SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
VC388
Plasmid#49958PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 sgATXN1L-1
Plasmid#74970PurposesgATXN1L-1, puromycin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-AR-S81E
Plasmid#171224PurposeMammalian expression of un-tagged human androgen receptor phosphorylation mutant: AR-Ser81Glu (AR-S81E)DepositorInserthuman androgen receptor Ser81Glu mutant (AR Human)
ExpressionBacterial and MammalianMutationAR-Ser81Glu (AR-S81E)PromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 sgCIC-2
Plasmid#74967PurposesgCIC-2, puromycin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
SL536
Plasmid#49942PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1246
Plasmid#49960PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 sgATXN1L-2
Plasmid#74971PurposesgATXN1L-2, puromycin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
BMR1_02g02691-bio-His
Plasmid#108042PurposeExpresses enzymatically monobiotinylated full-length BMR1_02g02691 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertBMR1_02g02691
TagsratCD4d3+4,biotinylation sequence, 6xHis (C termi…ExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
BMR1_03g01540-bio-His
Plasmid#108043PurposeExpresses enzymatically monobiotinylated full-length BMR1_03g01540 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertBMR1_03g01540
TagsratCD4d3+4,biotinylation sequence, 6xHis (C termi…ExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only