We narrowed to 10,837 results for: yeast

#184768

Marker for yeast mitochondria. Integration of 2xGFP tag at ABF2 C terminus. Uses auxotrophic marker URA3(Candida albicans).

Zhiping Xie

Li et al BMC Biol. 2020 Aug 28;18(1):107. doi: 10

Feb. 6, 2023

Academic Institutions and Nonprofits only

#184776

Expresses EMC1-GFP-APEX2 chimera for labeling yeast endoplasmic reticulum (ER). Uses auxotrophic marker URA3(Kluyveromyces lactis).

Zhiping Xie

Li et al BMC Biol. 2020 Aug 28;18(1):107. doi: 10

Jan. 19, 2023

Academic Institutions and Nonprofits only

#169261

S. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 WT

Susan Baserga

Bryant et al Proc Natl Acad Sci U S A. 2021 May 11;11

Dec. 5, 2022

Academic Institutions and Nonprofits only

#162842

Yeast expression of the mutant #2_6m for the RNA-based sensor of fructose-1,6-bisphosphate #2_6

Matthias Heinemann

Ortega et al Cell Chem Biol. 2021 Apr 22. pii: S2451-

Feb. 14, 2022

Academic Institutions and Nonprofits only

#177734

ER protein Elo3 with a C-terminal, an HA tag and the eleventh β-strand of GFP in yeast plasmid with URA marker

Erik Böttger

Cortes Sanchon et al Commun Biol. 2021 Dec 2;4(1):1350. doi:

Jan. 27, 2022

Academic Institutions and Nonprofits only

#119012

Mammalian expression of Rosa26 sgRNA, fusion protein of yeast Gal4 with human Rad18 Ubiquitin binding domain and BFP expression

Ralf Kuehn

Bashir et al BMC Biotechnol. 2020 Oct 23;20(1):57. do

Oct. 28, 2020

Academic Institutions and Nonprofits only

#108691

VTC4 sequence expressed in yeast plasmid

Michael Downey

Bentley-DeSousa et al Cell Rep. 2018 Mar 27;22(13):3427-3439.

May 2, 2018

Academic Institutions and Nonprofits only

#60327

Contains a promoter of two gal binding sites coupled with a core promoter derived from native Leucine promoter

Hal Alper

Blazeck et al Biotechnol Bioeng. 2012 Nov;109(11):2884

Nov. 6, 2014

Industry, Academic Institutions, and Nonprofits

#51747

overexpression of mouse Sedoheptulokinase (CARKL, SHPK) in yeast

Markus Ralser

Kruger et al Antioxid Redox Signal. 2011 Jul 15;15(2)

March 21, 2014

Academic Institutions and Nonprofits only

#182487

Yeast integrative plasmid for expressing fusion protein ERG20(F96W-N127W)-ClLIS1, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)

Claudia Vickers

Cheah et al Metab Eng. 2023 May;77:143-151. doi: 10.

Nov. 11, 2022

Academic Institutions and Nonprofits only

#154369

Yeast expression of Ost4

Wanzhong He

Jiang et al Nat Methods. 2020 Sep;17(9):937-946. doi

July 23, 2020

Academic Institutions and Nonprofits only

#87394

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87399

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87407

p425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only