We narrowed to 10,468 results for: yeast
-
Plasmid#96972Purposeish1-mCherry insertion cassette with Hygro resistance geneDepositorInsertish1 (ish1 Fission Yeast)
TagsGST and mCherryExpressionBacterialMutationish1 C-terminal domain fused with mCherry + hygro…PromoterN/AAvailable SinceAug. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH744-CEN-RLuc/slowmaxCFLuc
Plasmid#38224DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET32b-MED19
Plasmid#15438DepositorAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
pET41a-MED30
Plasmid#15431DepositorAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
pTH742-CEN-RLuc/slowminCFLuc
Plasmid#38222DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMGF170
Plasmid#96997Purposeish1-mCherry insertion cassette with NAT resistance geneDepositorInsertish1 (ish1 Fission Yeast)
TagsGST and mCherryExpressionBacterialMutationish1 C-terminal domain fused with mCherry + NAT r…PromoterN/AAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET41a-MED31
Plasmid#15437DepositorAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
His-FLAG-Med18 pBacPAK8
Plasmid#15371DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
His-FLAG-Med20 pBacPAK8
Plasmid#15372DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Med11 pBacPAK8
Plasmid#15373DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
myc-Med22 pBacPAK8
Plasmid#15374DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
myc-Med31 pBacPAK8
Plasmid#15375DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
myc-Med19 pBacPAK8
Plasmid#15376DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAvA139
Plasmid#248145Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen1' mutationsDepositorInsertluxR (gen1 mutations)
UseIntegration vectorTagsGal4 activation domain and nuclear localization s…ExpressionYeastMutationGal4_AD: N24K, P41 (CCA→CCG), N46D, T92S, V98 (GT…PromoterpPGK1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
Aga2p-TEVcs-LacAnc100-myc_pCTCON2
Plasmid#245298Purposeexpresses LaccID on the yeast surfaceDepositorInsertAga2p-LacAnc100
ExpressionYeastAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30-LacAnc100
Plasmid#234653PurposeExpresses LacAnc100 variant in yeastDepositorInsertLacAnc100
TagsHRV 3C protease site-GSG linker-8xHis tagExpressionYeastPromoterGal1pAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3
Plasmid#221112PurposeFAP tagged STE3 (N-terminally tagged, optimized for yeast expression) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3
ExpressionYeastPromoterSTE3Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only