We narrowed to 7,363 results for: Ank;
-
Plasmid#140240PurposeLentiviral vector expressing flag-tagged MIB1DepositorAvailable SinceJune 15, 2020AvailabilityAcademic Institutions and Nonprofits only
-
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CANX
Plasmid#227280PurposeDonor template for mStayGold insertion into the C-terminus of the CANX locus. For ER visualization. To be co-transfected with sgRNA plasmid px330-CANX (Addgene #227279)DepositorInsertCANX Homology Arms flanking a mStayGold Tag (CANX Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-TUBA1B
Plasmid#227321PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorInsertTUBA1B Homology Arms flanking a Puro-2A-mStayGold Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-miRFP670nano3-Blast-H3C2
Plasmid#207784PurposeDonor template for miRFP670nano3-2A-Blast insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3-Blast Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
TVBB C-term-mScarlet
Plasmid#169219PurposeTargeting vector backbone to support a knock-in of Linker-mScarlet at the C-terminus of a target locusDepositorInsertDouble SapI flanked mScarlet
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
2xMARS
Plasmid#205233PurposeExpresses two repeats of PLEKHA5 aa 143-271 (K163A and R164A) fused to mScarlet-iin mammalian cellsDepositorInserttwo repeats of PLEKHA5 aa 143-271 with K163A and R164A mutations (PLEKHA5 Human)
TagsNuclear Export Sequence and mScarlet-iExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-GFP-LoxP-SNAP-TERT
Plasmid#71391PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes GFP marker flanked by LoxP sites for selection.DepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AmCyan
Plasmid#138481PurposeFor cloning sgRNA flanked by two ribozyme elements, to subsequently cloned into PL-5LTR-GW-A vector.DepositorInsertAmCyan
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mTurquoise2
Plasmid#169222PurposeTargeting vector backbone to support a knock-in of mTurquoise2-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mTurquoise2
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-MAPRE1
Plasmid#227324PurposeDonor template for mStayGold insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mStayGold Tag (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInt-ERCreER
Plasmid#190040PurposeThis is an integration donor plasmid to insert a DNA fragment for doxycycline inducible ERT2-Cre-ERT2 at the AAVS1 locus. It works with an AAVS1 targeting CRISPR/Cas9 construct (Addgene #72833).DepositorInsertERT2-Cre-ERT2 flanked by AAVS1
UseCRISPR and TALENExpressionMammalianAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
LV-indLS2
Plasmid#123068PurposeLentiviral construct that delivers a tamoxifen inducible Cre. Upon recombination, luc2 and mStrawberry express. Used to image spontaneous tumorigenesis or subclonal cell populations in vivo.DepositorInsertsCreERT2 with intron
Firefly luciferase
mStrawberry
UseLentiviral and Luciferase; FluorescenceExpressionMammalianMutationsynthetic intron added as indicatedPromoterCAGGS (after Cre mediated inversion) and CAGGS (f…Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMT-sox10-cytoBirA-2A-mCherry_Ras
Plasmid#80062PurposeSox10 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterSox10 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-EMTB-TurboID-V5
Plasmid#190736PurposeMammalian expression of EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertensconsin (MAP7 Human)
TagsMyc, TurboID, and V5ExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino ac…PromoterCMVAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mNeongreen
Plasmid#169227PurposeTargeting vector backbone to support a knock-in of Linker-mNeongreen at the C-terminus of a target locusDepositorInsertDouble SapI flanked mNeongreen
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-GW-A
Plasmid#138480PurposeFor expression of ribozyme-flanked sgRNA after the Gateway (GW) LR cloning.DepositorInsertGateway attR1/R2 cassette with chloramphenicol resistance and ccdB genes
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBetaActin-FKBP-mScarlet-Dync1h1motor
Plasmid#191330PurposeExpresses the fluorescently labeled dynein motor domain fused to dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-mScarlet-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only