We narrowed to 8,392 results for: crispr grnas
-
Plasmid#238528PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKB
Plasmid#238527PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKA
Plasmid#238526PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 alphaDepositorInsertMpCKA
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_PflaBS-sgRNA500
Plasmid#149615PurposegRNA expression in B. burgdorferi, parental vectorDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaBSAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXZX351
Plasmid#169454PurposepRS426-SNR52p-gRNA.MATα_option1-SUP4t; 20-bp gRNA sequence targeting MATα cassetteDepositorInsertgRNA for MATα
ExpressionYeastPromoterSNR52Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NT)-PGKpuro2ABFP-W
Plasmid#163169PurposeLentiviral plasmid with non-targeting gRNA, co-expression of BFP tagDepositorInsertNon-targeting
UseCRISPR and LentiviralTagsBFPExpressionMammalianPromoterU6Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131C2.0
Plasmid#99886PurposeGolden Gate entry vector to express the 1st gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU6Available SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132C2.0
Plasmid#99889PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU6Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-eSpCas9-plus
Plasmid#126774PurposeExpression of increased fidelity eSpCas9-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as eSpCas9.DepositorInserteSpCas9-plus
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationK848A, R1060A; amino acids 1005-1013 replaced wit…PromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2112
Plasmid#91064PurposeModule B, Promoter: PvUbi1, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterPvUbi1Available SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-tagBFP
Plasmid#217007Purposelentiviral plasmid for gRNA cloning with selectable tagBFP expressionDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAIO3
Plasmid#137844PurposeCas9 and gRNA expression plasmid for P. falciparum; no selection in parasites.DepositorTypeEmpty backboneUseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-PspCas13b-GEMSgRNA2
Plasmid#204768PurposepU6-PspCas13b-gRNA-Actb1216 backbone (Addgene ID: 155368) containing guide RNA #2 targeting the GEMS m6A reporter mRNA sequence.DepositorInsertguide RNA targeting GEMS m6A sensor mRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
Fluorescent reporter for MOBE3-4
Plasmid#219946PurposeMammalian expression of 2x-deadEGFP(A111V/L202S) and aptamer-gRNAs to correct both mutations for MOBE3-4DepositorInsertCMV-EGFP(A111V/L202S); U6-A111V-gRNA-com-3'end; U6-L202S-gRNA-MS2-SL3
UseCRISPRExpressionMammalianMutationEGFP(A111V/L202S)PromoterCMV, U6Available SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS088
Plasmid#211502PurposeAAV genome backbone for AAV-Perturb-seq with direct gRNA capture and nuclei sorting based on eGFP.DepositorTypeEmpty backboneUseAAV, CRISPR, Cre/Lox, and Mouse TargetingExpressionMammalianAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEE393
Plasmid#149283PurposeT-DNA encoding TRV2 with Truncated FT augmented gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
SaCas9 GFP V3
Plasmid#226962PurposeCBh-SaCas9-2A-GFP, and hU6-sgRNA (Sa) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_gRNA1TERTKO_BsagRNA5tertko_2A-GFP
Plasmid#198863PurposePlasmid encoding for 2 gRNAs targeting the human TERT geneDepositorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -