We narrowed to 42,359 results for: LAT
-
Plasmid#49943PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only
-
Flag-M4-AR-S81D
Plasmid#171242PurposeMammalian expression of 3xFlag-tagged human androgen receptor phosphorylation mutant: AR-Ser81Asp (AR-S81D)DepositorInsert3xFlag-tagged human androgen receptor Ser81Asp mutant (AR Human)
TagsFlagExpressionMammalianMutationAR-Ser81Asp (AR-S81D)PromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mNeonGreen
Plasmid#196864PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Need1) fused to mNeonGreenDepositorInsertNedd1-mNeonGreen (Nedd1 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgATXN1L-1
Plasmid#74962PurposeCas9 + sgATXN1L-1 with blasticidin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgATXN1L-2
Plasmid#74963PurposeCas9 + sgATXN1L-2 with blasticidin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(B)
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLM3713
Plasmid#49946PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMG058 MBP-GS 634-666-His
Plasmid#154077PurposeExpresses MBP-GS 634-666-His (human 33aa Glycogen Synthase peptide as a fusion protein with MBP and His- tags) in E.coliDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
hHSF1 S303A
Plasmid#118363PurposeThis plasmid expresses human HSF1 S303A mutant, which cannot undergo sumoylation on K298 due to disrupted PDSM motif.DepositorAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-DN-RFX
Plasmid#52296PurposeDominant-negatively inhibits RFX (regulatory factor X) transcription factor. Made of mouse RFX1 DNA binding domain (400-527 aa) and C-terminal myc tag.DepositorInsertDominant negative RFX
TagsMycExpressionMammalianPromoterCAG promoterAvailable SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-3xNLS-OptoJNKi
Plasmid#89740PurposeExpression of light-regulated JNK inhibitor, mCherry-tagged, localised to nucleus, wild-type photosensor, inhibitor JIP11DepositorInsertNLS-OptoJNKi
UseFluorescent proteinTagsmCherryExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.2 (20-362)
Plasmid#177845PurposeBacterial Expression of SnRK2.2DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
MLM3727
Plasmid#49961PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKCAG-mCherry-OptoJNKi
Plasmid#89738PurposeExpression of light-regulated JNK inhibitor, wild-type photosensor, inhibitor JIP11DepositorInsertOptoJNKi
UseFluorescent proteinTagsmCherryExpressionMammalianPromoterCAGAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-NES-OptoJNKi
Plasmid#89739PurposeExpression of light-regulated JNK inhibitor, mCherry-tagged, localised to cytoplasm, wild-type photosensor, inhibitor JIP11DepositorInsertNLS-OptoJNKi
UseFluorescent proteinTagsmCherryExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKCAG-H2BmCherry-OptoJNKi
Plasmid#89741PurposeExpression of light-regulated JNK inhibitor, mCherry-tagged, localised to chromatin with H2B, wild-type photosensor, inhibitor JIP11DepositorInsertOptoJNKi
UseOptogeneticsTagsHistone2B and mCherryExpressionMammalianPromoterCAGAvailable SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
VC388
Plasmid#49958PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 sgATXN1L-1
Plasmid#74970PurposesgATXN1L-1, puromycin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-AR-S81E
Plasmid#171224PurposeMammalian expression of un-tagged human androgen receptor phosphorylation mutant: AR-Ser81Glu (AR-S81E)DepositorInserthuman androgen receptor Ser81Glu mutant (AR Human)
ExpressionBacterial and MammalianMutationAR-Ser81Glu (AR-S81E)PromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only