We narrowed to 16,208 results for: grna
-
Plasmid#128123PurposeCo-expresses sgRNA HEK, SpyCas9 scaffold (F+E) and GFP (transfection marker)DepositorInsertsgRNA HEK + GFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRSV/U6Available sinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hCRISPRi-v2, Gene Expression (h5), top 5 sgRNAs/gene
Pooled library#83975PurposeHuman CRISPRi Pooled Library targeting gene expressionDepositorAvailable sinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Cerulean-zhang2.0 Weiss full
Plasmid#79383PurposeCas9 gRNA variant to recruit ms2 proteinsDepositorInsertZhang 2.0 + scaffold
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-AAVS1
Plasmid#227272PurposeExpresses SpCas9 and a sgRNA targeting the AAVS1 loci for knock-in.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA Targeting AAVS1 (AAVS1 Synthetic)
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pS-cr:GFP
Plasmid#196295Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSsDepositorInsertFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
UseCRISPRTagsSpeI-DR-BsaI-DR-SpeIExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCF806-shRen.713
Plasmid#186712PurposeExpresses dox-controlled miR-E shRNAs (UT4GEPIR). Non-targeting control shRNA (shRen.713).DepositorInsertshRen.713
UseLentiviral and RNAiExpressionMammalianAvailable sinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
QPM-sgR (pTaU3)
Plasmid#140448PurposeFor sgRNA expression in monocotyledons protoplastsDepositorInsertTaU3-sgRNA
UseCRISPRExpressionPlantPromoterTaU3Available sinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro-humanU6-shRNA FASN
Plasmid#82327Purposeused to silence target human FASN expression via RNA interference (3rd gen lentiviral vector)DepositorInsertshRNA to target Fatty Acid Synthase (FASN) (FASN Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6Available sinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1 Rheb1 shRNA #2
Plasmid#26626DepositorAvailable sinceNov. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-ALB_DF_B358c_attB
Plasmid#182146PurposeTo insert attB attachment site at ALB in human cells via twinPEDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertALB_B358c_attB pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-ALB_DF_A277c_attB
Plasmid#182145PurposeTo insert attB attachment site at ALB in human cells via twinPEDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAlb_A277c_attB pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA1.1
Plasmid#64116PurposeVector for expression of St1 sgRNA1.1 in mammalian cellsDepositorInsertSt1 sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBBK10 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitURA3,AmpR)
Plasmid#178994PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitURA3DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK08 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitLEU2,AmpR)
Plasmid#178992PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitLEU2DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M9-IRES-CFP
Plasmid#114731PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA M9
UseCRISPRExpressionMammalianAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, BCR/ABL sgRNA 1
Plasmid#70659PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorPublicationInsertsgRNA against BCR/ABLamplicon found in CML-derived K562 cell line
UseCRISPR and LentiviralExpressionMammalianAvailable sinceOct. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -296
Plasmid#50926PurposeU6 driven sgRNA targeting Sox17 -296 bp from TSSDepositorAvailable sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Puro
Plasmid#167911PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by