We narrowed to 83,772 results for: Mycs
-
Plasmid#107924PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHL-H1-ccdB-mEF1a-RiH
Plasmid#60601PurposeCloning vector for CRISPR-sgRNA (into the BamHI-EcoRI site), expresses RFP and hygromycin resistance gene.DepositorInsertsRed Fluorescent Protein
Hygromycin resistance gene
UseCRISPRExpressionMammalianAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
Dronpa-FHA1
Plasmid#87711PurposeEncodes N-terminal (PAABD) fragment of bimolecular super-resolution PKA activity reporter (bimFLINC-AKAR).DepositorInsertDronpa-FHA1
Tags6xHis, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG
Plasmid#218163PurposeThis plasmid harbors the base editor eSCBE3-NG along with an sgRNA cloning cassette, facilitating high-efficiency cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-RL-ZEB1 200bmutx5
Plasmid#35537DepositorInsert3'UTR of ZEB1 (ZEB1 Human, Budding Yeast)
UseLuciferaseExpressionMammalianMutation5 mutations in miR200b seed regions of 3'UTR…Available SinceMay 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG
Plasmid#218159PurposeThis plasmid harbors the base editor SCBE3-NG along with an sgRNA cloning cassette, facilitating cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / L1111…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLINC-AKAR1-CAAX
Plasmid#87705PurposeFluorescent biosensor for super-resolution imaging of PKA activity; targeted to plasma membrane.DepositorInsertFLINC-AKAR1-CAAX
TagsC-terminal targeting sequence from KrasExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS17
Plasmid#107931PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG106 Lyn11-FAST
Plasmid#130721PurposeExpresses FAST (also called YFAST) fused to Lyn11 sequence in mammalian cellsDepositorInsertlyn11-FAST
Tagsmyc-tagExpressionMammalianPromoterCMVAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-T1977R
Plasmid#69011Purposeactivating MTOR mutationDepositorInsertMTOR-T1977R (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Threonine 1977 to ArginineAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-cpVenus-FLARE-AKAR
Plasmid#123329PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity. Contains monomeric Venus/cpVenus-E172 homoFRET pair.DepositorInsertVenus-cpVenus-FLARE-AKAR
Tags6xHIS, T7 tag (gene 10 leader), Venus, Xpress (TM…ExpressionMammalianPromoterCMVAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-EGFR*-CUbo
Plasmid#212821PurposeConstitutive or doxycycline-inducible expression of EGFR*-CUbo in mammalian cellsDepositorAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-ProtC-AU1
Plasmid#162111PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-ProtC-AU1
UseLentiviralTagsStrepTagII-ProtC-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-ProtC-FLAG
Plasmid#162090PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-FLAG
UseLentiviralTagsStrepTagII-ProtC-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-ProtC-FLAG-AU1
Plasmid#162097PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to ProtC-FLAG-AU1
UseLentiviralTagsProtC-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-StrepTagII-AU1
Plasmid#162082PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-StrepTagII-AU1
UseLentiviralTagsVSVg-StrepTagII-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-StrepTagII-AU1
Plasmid#162102PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-StrepTagII-AU1
UseLentiviralTagsVSVg-StrepTagII-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-ProtC-FLAG
Plasmid#162104PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-ProtC-FLAG
UseLentiviralTagsVSVg-ProtC-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only