We narrowed to 9,186 results for: mel
-
Plasmid#52419PurposeConstitutive mammalian expression of ERAS. Upon CRE mediated deletion of ERAS insert, dsRED expression markers is truned on due to concomittant removal of stop cassette.DepositorInsertERAS (ERAS Human)
PromoterCAGGSAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-sgCTG-CAG-Cas9D10A nickase-Blast
Plasmid#216733PurposeExpresses SpCas9-D10A nickase under a CAG promoter together with a blasticidin resistance gene, along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Suitable for lentivirus packaging.DepositorArticleInsertCas9-D10A nickase and sgCTG
UseCRISPR and LentiviralExpressionMammalianMutationD10APromoterU6 and CAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-SpCas9D10A nickase
Plasmid#216735PurposeExpresses SpCas9-D10A nickase from a miniCMV promoter. For AAV packaging. Derived from pX551-miniCMV-SpCas9, which was a gift from Alex Hewitt (Addgene #107031)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterT7 and mini-CMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20 MEF2C S222A
Plasmid#89718PurposeLentiviral gene expression vector for doxycycline inducible MEF2C-S222A expressionDepositorInsertMEF2C (MEF2C Human)
UseLentiviralExpressionMammalianMutationChanged serine 222 to alanineAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-hgp100-PuroR [M1G]
Plasmid#171801PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-hgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M4/X184PG-IRES(isoform 2)
Plasmid#99568Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M3/Y92C-IRES(isoform 2)
Plasmid#99567Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M2/X184W-IRES(isoform 2)
Plasmid#99566Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M1/R141L-IRES(isoform 2)
Plasmid#99565Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-Tomato MEF2C S222A
Plasmid#89716PurposeRetroviral gene expression vector for MEF2C-S222A expressionDepositorAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-Ova-PuroR [M1G]
Plasmid#171813PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and puromycin resistance cassette [p.M1G]DepositorInsertmScarlet-F-Ova-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES_Tomato MEF2C S222D
Plasmid#107231PurposehMEF2C phosphomimetic obtained from Quikchange Lightning MutagenesisDepositorAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M2/X184W-IRES(isoform 1)
Plasmid#99560Purposemammalian expression of mutant TMEM230 (isoform 1) and ZsGreenDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M1/R141L-IRES(isoform 1)
Plasmid#99559Purposemammalian expression of mutant TMEM230 (isoform 1) and ZsGreenDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-spCas9
Plasmid#231404PurposeExpresses spCas9 from hSyn promoterDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB OROV Gc Spike H6
Plasmid#229662PurposeMake PiggyBac stable cell line expressing Oropouche virus BeAn 19991 Gc spike region (residues 482–894 of M polyprotein) with C-terminal His6 tagDepositorInsertOROV Gc spike
UsePiggybacTags6xHisExpressionMammalianMutationcontains residues 482-894 onlyPromoterTREAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-ΔPLD
Plasmid#195479PurposepInducer21 plasmid containing the human MEFV gene with a deletion of residues 88 - 310 (the resulting pyrin protein lacks the Phosphorylated Linker Domain domain) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationdeletion of residues 88 - 310 (the resulting pyri…Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only